Description :
From Genome Similarity Track
Location :
Scaffold_403:5- 1258
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_403-snap-gene-0.5Major Facilitator Superfamily (MFS)

Sequence
1253 bases(100 bases per row)
TCGGCGGGATCATTCAAGCGAGCACATCCACTCTTGAGGTCTTCATCGTCGGCCGTTTGATCGCTGGTGTCTCGTCTGGTTGTGCGACTGGCATGGTCGG
CGGCTACGTGAACGAGATCGCGCCACCCAACCTGCGCGGCAAGTTCAGTGCCGGGCTGCAAATGGGTGTGTCGACCGGTACACTTCTTGTCGTCTGCACC
TTCTTTTTCGCCAACACAAGCTCCGGCTGGCGCTACATTGCAGGCTTCCAGGTCCTGTACGGCATGGTCTTCATCGTGCTCGCGTCCTTCTTGCTTGCCG
AGAGCCCCGCGTGGCTTCTCACAAAGAACAAACGCGACGAAGCCGCCCAGGTCATGACTCGCATCTACGGAGAAGAGCATGTTTCGCTCGCGTTTTCGTG
GTTTGAGCCGTCAAATTCTGCTACAGACATCGAGTCGCCGCACGCTGGATCAGAGGAACAAGATTCGGGCTCCAGCCACCCACAAAGCACGACATCCCTG
CTCTGCTCTGCACTCTTTCGACGCCAACTTGTCATCGCGATCGGTATCGCCTCAGCGCAGCAGCTCTCCGGCATCAGCGCCGTCTTTTACTACTCGTCGA
GCATATTCAAGGACGCCGGCATCTCGGACGACCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCCTCATCGTCAATATCATGAACTTCCTGCCAACCTTCACCACCGGCTACCTGGCAACGCGTTTTGGCTACCGACGCATCATTCT
GTTCGGCTTCCTGGGCATGCTCGTGAGTGCAGTGGGCATCACGATTGCGTTCCTCTCGAACGTAGCAGAGCTCTCCATCGTCTTCACCGGCACCTACGTG
GCGGTGTACTCGATGAGCCTTGGTCCACTTATCTACGTCGTGACGGCCGACCTCTTCCCTGATGCCGTGCGTGGCTCAGCGGTGTCGCTCTGCATCTTCT
TTAACTGGATGTCGAATCTTCTCACGGGGATCACGTTCCCATACATCGCCGACGCGCTCGACAACCTCTCGTTCCTGCCGTTTATCGCCATCCTCGTCTT
CTTTTACGTCTTCACGCTCAAGCTCGTGCCGGAGACGTCGGGCAAGACGAGCG