Description :
From Genome Similarity Track
Location :
Scaffold_496:5- 1250
Sequence
1245 bases(100 bases per row)
GACAACCTTACAATGGCTTGTCTCCTCACAATAAAGTCATCGACTTGCTGTGCCTCACGACTTGTCATGTCGTTTAGAGGTTTCATCGAGTCAAAATTCG
CTTTTAACTCTGTGACAGCATTCAGGTCCGACTGTGGCTCCTTAGCCGCAGTCTCTCCCCCACTTAAGGTAGAAACCTCTCCCACTAGTGACGCTGGCAC
TCTCGGGTGGAGTCCGTAGTTCACATAGAACGGGGTATGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTC
CACTCTCCGAAAGATGTTGCATAGCTGCGCAATACATCTTCCAGGACACGATTCACTCGCTCTGTTTGACCATCCGTTTCAGGGTGTGCCGCTGTTGACA
TGGACAACTTGGTGTCCAGAAGTCTGAACAGTGCACGCCAAAACTTGGATGTGAAACGAGTGTCACGGTCAGACACGATCTCGACTGGTAGGCCATGTAG
ACGGAAAACAACGTCTACAAAGACCTTGGCCGTCATTTCGGCTGAGATCTTGTCCGAAACCGGTGCAAGATGGATCATCTTACTGAATCGGTCCACAAAC
ACAAGGATGCCATTGCGTCCGTGTTTGTCCCTTGGAAGTCCGAATATGAAATCCATACTCACGGACTTCCAGCTGTCAGTTGGCACTGCCAATGAACGAA
GTGGGGCTTGTGTGGAGCCAGAGGGCTTCACACGCTGGCAGATTTCGCAAGTCCTCACATACTTGCGAACCCACTTGTGCATGTGTGGCCAGTAATAATC
CCGGGAAAGATTGAGAAACGTTTTCTCACGTCCGAGATGACCACCTGAGGGACTGTCATGATACTCATACAAGAGTCGATGACGCAGGCCCTCGTCGTTG
GGAACAACAACCCTTGCTGTATCCCCATCTTCAACCGCATAGTACAACAACCCATTGTGTACTTGGAAGCGGTGAACACGCGATCTTGTTCGAGCAGGCA
AGCTCTGCAGTGCTTTGTCCGAAGGATCTTTGAAGTACTTCAACAAGTCCTGACATGTGTCGTCAGACTTGTACCCTTCGACAATCTCTTCTCGCACTGT
CGTCGTGGCTTGAACTGCGATCGCTTGAACATCTTCGCAAAGTCGACATTCTTCGTCCAGATTGTCACTCTTGGACTTCGGATCGTAATCCGGACGTCTT
GACAATGCGTCGGCTAAGATGTTCGTCTTGCCTGGCTTGTAGTGT