Description :
From Genome Similarity Track
Location :
Scaffold_4004:5- 1189
Sequence
1184 bases(100 bases per row)
CGGAGTTTTCTGTCGAATCTGATCCAATCAGATTCTCTGTGTCGTTTCCCAGAATCGACACACATTCACTTCCAACGACTTCGGAAGTCGTTGGAGCTTT
CTTTATTCACGCCCTGCGCGTCGAGACAGCAGCGTTAACCGCTGTCTCTACTGGAATGCCGCATGCACCTTGCGGTGCACGTGTCGCGCTGTCGCGACCG
AAGCGTACGATTGtacgcttcttccagttcatTTTCGGGtcatgcccagcaccaagtcgaacttgtcgtctaaGTCTAAGACGGTAAAATCCTCAATAAA
TCTCTTTTGTTGATATGAGAAGCGTATGGCACGCTTCTCGTTTTTCACGACGGCACCTGTTGCCAGTCGTACTTTCAACATGCTTCGAGGGGtttgcacc
tcctcgaagtcaaCGCTTGGCAGAGTCTGCAGTCGAGCAAAGTTGTTCGACGCACCGGAGTCTACTAAAGCTCGAAGAGAGTTCGCTCTCTTCGAAgaca
cgtccaggatgacaaGGTTGGGCTTGTCATCTCGCTTCTTGCAGTGAGATTGCCTCTCACTGGGGGCCGCAGCCTTCATTGACGCGTGTCCGATGTCGAC
ACGCGTGACTGCTTTACCAGTAGGGCGTCCCGCGCCTACTGGTTCCgcgcgtttttttttaatggATCGTAGCGATGccctgcatcgccacgttgACCTC
TCTGCCCGTGCACAAGTGCTGTGCACTCACGCGCAAAGTGACCGATGCGTCCGCAACGGAAGCATCGTACGTCAGCTccgcgacgtggtgggtTGTTCCC
AGCCGTCGCGTTCAAGAGGTCCATTGGTTCTGGACCTCCCGTCCTTATCATCGGACGTGGCATCCGTGGCACGTTCACATGCAGTTTAGCCTGCTTCAGG
CTAAACTCTTCTTGCATTGCGAATGTgatcgcagcttcgagagtACTCAGGTACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCCTTCAGACccttca
tgaacgtgacgaccTTAGTCGCCTCGTCTATCGGGTTAGTCACGATGTTCGAGACCAAGTACCGTGCCCTCTGGGCGTAAGCATGGGCATCATACTTACC
CTGCTGTAGATCGAGGAACTCTGCCCTCGATCGGAATTCGTTTTACGGGGCTCAAACGCTTGTCTGAGCTCCTCCTTAAAGGTC