Description :
From Genome Similarity Track
Location :
Scaffold_398:5- 1181
Sequence
1176 bases(100 bases per row)
GATTTGTGCAGTTCTAGACGCGCTAGCTTTGTTAATGACGTATCCGGTAAACAGATCCACCCCGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGT
AACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGTCTGCCTTTGCCTGTCT
CGCAATCCACACATTCACCGACATATCGTTGCACACTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATTCCCTG
ATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACG
CTCTTCGTAGGGGGACAATAGAAGAGCAAATCATTCACATCCACTGCATAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCTGACTCAGGTCTC
TTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCATTTTGTGCTTTGAGGATCCGCCCAATGCGGACTCCCTTCACAAATGCTTC
ATCGAGAATCTGGGGGCTGTCCAACCCTTCCTCTGGAGCTAGTGACAGTCATTACCTGGGCTGTCCTTTTTACGGATCCAACCACCACCACTTTGTCTAG
TCGGTTCAACGTGACGAGATCCTGATGCTCGACCTTTCTCTCCACCTCGACACCACATTGATTTCGTGAAGCGGCACTGGCCAAGCTATCTCCACTGACA
TTCCAATCTCGATTGACATGTACCAACCTGTGATTCATCCAACCACGCAGGTGGACCATCACCTTCTGCCGTAACAGCGTAAGGGCAGGGACCTTGCAGT
CAATCTCACCTTGCACCTGTCTGATCACCAAGTTTATATTCCCACAAATCACCAGCCTTTTCGGATCCTGTCCCTTTAGTAGATCCTGTTGTCAAGAAGG
CGTCTCGTCCAACTTCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACATAT
GATTGGACGAACAGGATGATTGGACGAGTCCAGAGTGTTGGTGATTGGATGCACCACATGATTGGATGCAGACTAG