Description :
From Genome Similarity Track
Location :
Scaffold_1098:5- 1154
Sequence
1149 bases(100 bases per row)
AGGGTATAAGGATGATGGATGCAGTGGATCTCGAACTTTCGTGGGACCAAGGAGATCACAGAAGGTTGCAAGATGATGTTGAATGATTGGAGAGCTCGGA
TCCACGGCGAATGTACCATTACAGCGAGGTGGATCCAAGCGACCTAGATCCGGATGAGTGTACCCATAACAGGGTGACCATGATGATTACGTCATGGATC
CGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAG
GTAGAAATCCAGGCAGGTAAAGCCTTAAATATCAATACAGACTCCAATTTGCACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAGCTACATT
GGCCGTACGAGCTCGGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAAATCCTACAGCCTAGTGAGCTTTTC
CTTTACTTGTGCAGACCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGAGGCTCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAA
GTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGTAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATT
CGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACT
TGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCC
TCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTGGCTGATCCCGCTACACCACAATACTAAGTTATTTATCCAAA
GGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAATATCTTAACTTTATGCTTCAAAACCAGAAGTCTTTTATTTACTATTATTGCGGCCAAGCCGCCT
AGGGGTAAATGTATCTCTTTAACTATCTAGCATTGTTAAACCTAATCAA