Description :
From Genome Similarity Track
Location :
Scaffold_4491:5- 1105
Sequence
1100 bases(100 bases per row)
ACAACGACGCGAGGAGCATCGAATCGATCGATACTGTACATCAGTAGATCACCGTCAAGTTGGTATCTGTGAATCTGGTCGCGCGTTAAGCGGCTCAGTG
TCTTTAGCGTGGCATCACTTGGTGTGCGAAGGTGTTCAGGATACCGGCATATATCGAGTCATCTCGATACGCGGCAGCGATCTCTTCCCGCAGGGGAAGT
ATTGGAGATACCGTCGTCATCAGGTTCACACCTGCAGCCACACATGTGGCGCAGTCCAATTCGTCGTCGTCCGCGTCTTCATATGACTGACGACCCAAAT
CTCGGCGTGGATCGTAATCGGGGCGCCGAGATAGGGCATCCGCAAGGATGTTATTCTTGCCTGGCTTGTAGTGAACGACGAAGTTGTACTCGGAGAAGAA
TGACAGCCATCGTGCCATGCGCTGAGAGAGATGAGGGCTCTTCGTCGCTGTTCGCAGCGACGCGTGATCTGTGTAGATCGCGAATGTCTGCTCACCGAGT
AAGTACACTCTGAATTTGATCAGTGCGTAGCGCATCGCAAGGAGTTCCTTGTCGTGGACCGGATAATCCTTCTCAGCGGGCTTCATCTGTCTGGATTGGT
AGCTCACGACGCGTTCGCGACCTTCGTCGTCGAGCTGCATCAGTGCACAGCCGATGGCGAAGTCGCTCGCGTCGCAAACAACGTGGAATGGCTTTGCATC
ATCTGGAAGCGCCAGGATTGGGGCCTCCGCCAAGCTTTTCTTCACTGCATTAAAGGCTGACTGATGTTCGGGAGTCCACGACCACGTGATGTCTTTCTTC
AGCAATGAAGACAATGGCTGGATCAGACCAGCATAATTTTTCGTGTACTTGTGGAGATAATTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTAATTCT
GCGGCGTGGGCCACGCACAAATGGACGAGACCTTCTCAGGATCCGCTCGGACACCATTTTTGCTCACATAACAGCCAAGCACCGGGATCTCCGGGGCACA
GAAGATGCACTTCTTCAAGTTCGCGTACAGTTTGTTTCGCGCATGACTTGGAACACTTGTCGTAAGTAGATGTTAAGTGAACTTCTGTGGCGCTGAGATC