Description :
From Genome Similarity Track
Location :
Scaffold_1806:5- 1071
Sequence
1066 bases(100 bases per row)
ATCACGTATCCGGTAAGCAGATCCACCCAAATCAACAACTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGA
AAGCGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCATCGACATATCGTTGCAC
ACTCTTGAATAGTCCCCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCACCTTCTAAGCTAGCGTGATAGTGGTGT
AGGACATCCTGTTGTAAGGTTTCCGGTATCACTCATCTCTCATCAACTCATCCCAATCTTCGTTGACTCTCTTTCGCTGGGGGGGGGGGAAACAATAGAA
GAGACAGTCCATTCAGATCTCACTGCGGTAATCTCTTAGCGATATATATCGTTAGGAATGGGCATCCTCCCGCACTCCAGTCTCCTAACACTCCCCAATC
AGATAACTCTCTTAGTCCCAAGATCACGCTTTCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATCTGGG
GGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTGTCCTTTTTCCGGATCCAACTACCACCACTTCGTCTAGTCGATTCAACGT
AACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCGATACCACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATCTGCGCTGGCATTCCAATCTCGC
TTGACATGCACCAACTCGTGATTCATCTAAGCCACGCAGGTGGACCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCT
CGCACCTGTCTGATCACTAAGTTTGAATCCCCACAAATCACCAGCCTTTTCGGATCCTGTCCCTTTAGTAGATCCAAACCTAGCAGGAGCCCGTTATACT
CCACTTCATTGACGATAAGGCCCTCCGCATAAGTATGTGGTGTGATGGATTTTCCCCCGGGTTTTC