Description :
From Genome Similarity Track
Location :
Scaffold_6957:5- 1056
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_6957-snap-gene-0.13'5'-cyclic nucleotide phosphodiesterase

Sequence
1051 bases(100 bases per row)
CGTCGACCGTTGGGATCTCAGCTGTCTCGACTTGTCGAACGGTGAGATCTTCATGTCGATCGCTGTGATTTTCCGCGTGTTTGGCATTGGCGAAACGTTT
CGCATTTCGCACGACAAGATCTCGACATTTCTGTCCCATGTGGCCAGCCACTATCGCCCGAATCCGTTCCACAACTTTCAGCACGCATTTCAAGTCATGC
ACGCCACGTATAGTATCATTCGCCTCGAGTGCAGTCAGTACTTTTCGCTCCTCGACATCTTCACCATGCTCATAGCCGCGCTGTGCCACGGTACGAGCTC
TTTCTCTCTCTCCCTTCTTTTTTGCTGGCATCCTTTACTAACATCACGCACTTTATGGTCTGCGGCAGATATCGACCACCCTGGCAACAACAACGATTTT
GAAGTCAAGTCGTTGAGCCAAATGGCGCTCACTCACAACGATGATGCTGTGCTCGAGCGCCACCACTGCCGCGTGACGTTCATCATTTTGGGCCACGCAT
CCGCCAACATCCTGGAGAATCTGCCGCGCGAGAGCTTCATCCGAGTTCGACGACTCATCATCCACTGCATTCTCGCGACCGACATGTCCAAGCATTTCGA
AAAGTGCAAGACGGTTGAGGCGCTCACGAGACGCCACTTGCACGAGAAAAAGTACATTCTGATGGCGGTCGTGCTCCACGCAGCCGACCTGTCTGGCCAA
GCGCTTCCATACGATCAAGCCATCCGCTGGGGCATGCGTGTGCTCACGGAATTCCAGAATCAAGCGAAAAGCGAGACCGACTTGAAAGTGCCCGTGGACT
CGTTCATGACCAATCTACATCAGATGAAGACCCGTGTGACTGTGCAGATGAACTTTATCAACTACGTCCTGCGGCCCATTTGGCGTCCACTCGCAGCTCT
GTGCAAGGAGCTCTCCGTGTACTCGGACTCGCTCGAAGCCAATTTCGAATATTACAAGACCGATCTCGAGCGACTGCTTGGGCATGGGGTCCACGACGAA
CGCCCCGTCCAGTATGTCCGAGGCGACAGCTCACGCTTGCTGATCAACAAA