Description :
From Genome Similarity Track
Location :
contig_126:49997- 52925
Transcript NameFunction/comments
g14066.t1hypothetical protein
g14067.t1OWZ18425.1 Membrane protein [Phytophthora megakarya

Sequence
2928 bases(100 bases per row)
ACGCGTACCACGTGCTGAGTCTCTACGGCCGCACCAAGAAGCACCTGCAGAAGCTCTTCCCCGACCCGAGCGACAGCGAGATCGAGTGGCTGCGACTGCG
CACCAAGATGCACGAGATGATCATCGCCCAGCACCTGCGCTTCACTCTAGTGGTGCTGCAGCAAGCCGAGGCGACGGATATCGCCCCAGAACCGGTTGGG
CGTGGACCCGTGGAGGAGACGGCCAACGGATCGAAGGAGGAAGAGAAACCAGTAGCTGCTACGTGATCCTAGAAAGGAGAGGCGAGCTGACTCGTGGCAC
TGCGTGGGCCCAGCAGAGTGAAGGTCGTACTACAAGTCGTACTACTTGAAGTTGAAATCGCAACGACGTAGCGTGTTTACTTAAGAACCGGACCGGACTG
AGTTTGTTTTCAAGCTGCAGCTGGTGACGGTGGATGTTGGACACAGGGTCGGCGTTGGACACTGGTGCCAGTGGCAGCGTACAGACTCACAATCGACGCA
AGAAGATTAAGATAGGCTGTCCAGCCAGCGGTTAATCTTGGTTCATCTTAAAGTTTGGAACCTCATGGTTCTGATGATCCAGTGGGGTGGTTGCTCCGTC
ACTTGGTGGTTTGTGGTGGCCTACACGTTGGCGCTCGCTGGTGCTGTCAATTGATACCCACCACATCGCACCAAGGCGTTTTGCGTGCGTGCGTGTTGCT
GCTGGAAAAGAAACGCCGTTTCTGGACAGCTCTGGATTATAGGTATATGAATGTTGTAGGTGTCGACAGCCCGTCTCAAAAATCGTGGCGTGGCGTGGCT
CTCTTACTCAGAGTCTGACCATCGCACCGATCCACGCGGTAAAGCTCAACTCTTGTCTGCACACTGTACTAACAAAACCCTTACCGCCACACCACCAGAC
CTTACCACACACATTGCAACTGCCAAACCGCTGCACTTAATTAAGCTGATGTTTCTGCCGTTCCCCGGCTCAAAACATGCGATTGCGAAGCCTTCCACCA
GCGCTTCGAGTTATCATCAACGGCCCGTGATACCCACACCGACCGACTCGACTCGCCCGCCCTCCACAATAGCACCAATAGATAGCACTTCTAAATTTGC
TGTTCGAGCAGCAAAAGCCTCTTCCGACTCACACCTTCGCCAACCGCTATGGGCTTCTTCGACGAACAAGTGGGCGTCAAGGTGCCCCAGGTCACTGTCT
ACTTCTGGATCATCAAGGTCCTGGCCACGACGGTCGGTGAGACGTTCGCCGACTTTCTCAACGGAAATGTTGGTCTCGGTCTGGGCGGCACCTCCGGCAC
CATGCTCGCCATCCTCTTGGTGGCACTCGCGGCCCAACTGAAGCTCGACTTCTACTTCCCGCCGCTCTACTGGTTCGTCATCGTCGCCATCAGCACTGTG
GGCACTCTGCTAAGCGACAACCTCACGGACAACCTCGGCGTTTCGCTGTCGGTGACCACCCCCATCTTCCTCAGTCTGCTGGGGGTTGTGTTCCTGGCAT
GGTACCATTCCGAGAAGAACTTGTCCATCCACAGTATCTTCACGCGGCGTCGGGAGGCGTGGTACTGGCTGACCGTGCTCGTCACCTTTGCGTTGGGGAC
GTCGGCGGGAGATCTCATCGCAGAGAAGCTCGACGTTGGCTACGGAAACTCGTTGGTCCTCTTTGCAGGTTGCATCCTGTTCGTGGGGTTACTATGGCGG
TTCAAGGTGATCAACGGGGTGCTCGGCTTCTGGGTGGTGTACGTGCTGACTCGGCCGCTCGGAGCCTCGCTGGGAGACTTGATGTCACAGAACCCGGCGG
ACTCGGTGGCCTCGGCTTCGAGCTCCGGGTCGGGCTCATCATCGGCTTCGGCTTCAGCTTCAGCCTCCGAGTCGATGTCTGGGTCTGGCGAGACGGAGGA
GCTCCCTTCCGGTTGGAAGACCGGCCTCAACCTCGGCACGACGGTCACGAGTATGATCTTCTTGGCTCTCATCGCAGTGTTGGTGGCTTTCTTAACCATC
ACGAAGAAGGACGAGCTGAAGGTCGAGTCTATTCACCCTGATCTCGAGAAAGGGGAGGAGCCAGGGGCTACCTCGACCACTTCAGTTCAACACGAGTGGA
CGACGCTACCCGACAATGCAGCGCGGTAGACTGTCTTTCAAACTGTGAAGGTACTTTCCCACTAAGACCAATGCGTCGAATCTCAAAACCTACAACACCA
CCCTGTGCATTTGAAACTTGCTTCGTTATACACAATATCAATACGTCGAAAAGAAAGCAAACGAAGTGTATACTTCGTTTATACGCATACTGCGTTGAGG
ATTGTTTTGCTATGAATACGTTTGGCATACATGTCCCCGCCTACTCCACACGAGTGATCGGTGCCGACGGGAGCTCGCTCTTCCTCGAGCGCTTGCGCTT
GCGCAGGAAGAAGGTTTTGAGGTCGTGTTAAGTAGTAGTTTGAAGTACTACAGCAGCGTACATGGTCATGTTTGTAATAAAAGGAGTTAAAACCCTTGAC
CAAATTCGTGATCAATTTCAAACTGCCGCTTGCGAAGCCTGGACAATCGTCAACAACAGACAAACCTCTAGCTGGATCTGAAGTGCTGGGTGACAAGGGA
GCTATTTAAGCTACAACAATATAATATATAATATAATTATTGGACGCTCCGCTTGTGTAGCAGAGTGAAGGTCGTACAAGTTGAAGTTACAGTGCAGTAA
GGTGTTTACTTCTGGGTATTTTTTTCTAGTTGCAGCTGTAGAGCGACGTTGGACACAGATGCCAGCGTAACATCCTTTGGTTCACAATCGGCGCCAGCGC
AATCGCATTTCACGTCTGCACTCAAGTGTCCTAACCCTTTTGCATCGTATTCTACGAACAAACAGGGAAAATGGAGTCTTCCTGACAATATGGATAGGAA
CAAGTCGTGTTGTTACGCATCGATGTCC