Description :
From Genome Similarity Track
Location :
Scaffold_1329:4999- 6515
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1329-fgenesh-gene-0.3HECT ubiquitin ligase
Pytiw_DAOMBR242034maker-piw_contig_1329-fgenesh-gene-0.2HECT ubiquitin ligase

Sequence
1516 bases(100 bases per row)
AACCCGTTCCGAACAACAGTAACCGCCGACGGTACTCGTCCGGCATATCCCCCACCACCTGCCAAAACCAGCGCATGACGCTCGATCCGTTGAGGNNNNN
NNNNNCAAGTCATTCATTCCTGTCCACGAATTCATAGTAGGTACAATTTTGCTGAGACCCTGGAAACGGTTGAACCTGTGACCAAATACTGATTTGACCT
TTGGGCTGACGGATTGCATCCTTTTGTATCCAGTACACAAAGTGGGTGCGCTTTTATTCCAGGTACTCTACTTACCTCAGATGATCCGTCCACTGCATGT
CCACAGCAAGATCTCTTGGGTTCTCTTCGCCATTTGCCAATTCGCCTCACAACTGAGACTACCACCACTACCAGTCTTCTAAATCAGAGATAAACAATGG
CGAGCGCGTGGCAATGGGGGGCCATCGTCGTCGGCATCGTGCTCATGTTCGTGGCCATCGGCCTCTTTCTCCGCGCGGCTAAGCGAGCAGTGGATAGCTA
CAACGCTGAGCAGACGCAGCTCCAGGCCGCGCTTAACCCCGACGGAGACGTCGAGCACCGCCACGAAGTCGCCATCAAGTATGTGGACTCAGTGTGGCTC
TGTCGTGGTTTGAATGGCAAATTCTGACGTGTACATATATGTATATATCTATCTACAGAGTGGCGTCGAGCGGCTACGTCGAGTGCCCGATTTGCAACTT
TGAGAACTTCACTAGCGTCACGCACTGCACGCTTTGCCAGACCAAGCTGGTTGTCGTGGGGACGGCACCAGGCTCCAATCTACCAACAAAGGGTTAGGAG
CGGCAAGGTCGCTCAAGCTCGCGACAGCGAGTGAGTTTGTAGCGAGCAGCCTAAGGACTTCGGGCGTGTGGTGATGGTCGCATTTTTACGACCACTCTTG
TCCACATATGAGAATTGTAGTCCCACATGTTTGTCTAAATCGCACCCACATTTATTGCTTTGCTTCGCACCTTGAATAATTTCGCCCATCTCCTTACTAT
TTTCAGCCAATCACAGCCAGTTTCGAAAAAATAATACACCAAGCACTGTCTACATTTTGGACATCACCAAGAGCTCAAGAGCTCACGAAGAGCTCAGCTC
AGCTCACGAAGAGCTCAGCTCAGCTCACGAGGCGCGTCGCCACACACTCAGCGGCAGGAGCTCTTAGATAGAGACACACAGACATCAGACGCCATGAGCC
CCACGCTGCTGCAGGTGCTCTGCTTCGTGGCCGGTCTGGCGCTCATTATCGCCTGCGCGCTCTACATCCGCTGCCAGAACAACCGCGAGTACGCGCAGAT
GCAGCTGCACGCGCCGCTGCTGGCCGCGTCGCTGGACGGGCTCGACCGCGACTTGGTGGCCGCTCGGTGCGTTCCTGCGTGCTTCTCTGTGGCTATGTGC
GTGGTGTTGCTGTGGAGACTGTGTTGCTGAATGGTGCTGTGTGGATGTTGTGTGTTGAAAACAGAGAGGCCGAGCTCGGATGCCATGTGTGCGACGCGTG
CGGCTTTGAGAACTTC