Description :
From Genome Similarity Track
Location :
Scaffold_1091:4998- 9195
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1091-snap-gene-0.10Kinesin
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_1091-abinit-gene-0.20Notchless family protein

Sequence
4197 bases(100 bases per row)
GGCCTCGAGGCATGCTTTCACTTCTCGCGCGGTGCGGATGTGGATATTTTCCTCTAACTCACACTCTGCCTCGAGTTGCGCGAGCCNNNNNNNNNNNNNN
NNNNNNNNNAACCTGTTTGTAGTACTCGACGTCCTGTGCGCGCCTCCGCCGTGTTTTCGTCACAAAACTCTCTTTGGTGGATGCTCCATTTGCATTCGCA
GTAGAAAGCATCGCTCTGCCTTTACTAGAGGAAAATAACGTAGAGCCGGCACTCTTCGACGACTCGCTTGGATGACATTGAGAATCGTTCAGCGTCTGAT
TGCTTATGCCTTGTGCCGCGACGAGCTTCTTGTTCGTCCTCTGGTTGCCATCACCTCTTGTCTGGTGGCCGCTGTCATGAACCGCAGACAGCTTCAATTT
CCCAACAACAACCCCGGGACTGGTCGACGAGGCCGCCATTGTCGATATCTTGGCGCGCAGACGCTCAATCTCGACGCGATACTCTTCAATCTCGACTTCC
AGCTCTTGGAAGCGAAGGAACTTGCTACGCATGTAGCACACAGTGGCAAATTGTAAGCGTGTGGATTTTGCATTGGTTATTATTACCTGCACATCAGCCA
CACCTGCTGTATTTGAGCCGATCGAGCTCCTTTTTACGCTCATCTGCGATTGCTTCTGCGTTCACAATCTAGCAGCTTGACACAAATTGCGCTGAATGAA
TGGTGATTGAAAGGTGGAACGAAACAGGTGGTTGAGAAACGTACGCGCTGCTGGTTTTCCATGACCAGACGGTCGATCAGCTCGTTCTTGCGCTTCTTCG
TCAGCTCGGCATCTTGTGGCGCGCGAAGAACCGCAAACACTGCTTGAAGCTACAATACAGGAACGTGTGTTTGTCTAGCTGGCATAATAAAATGAGATAA
TCCGATTCGCGCATGGATGGTACCAACGTCTTTGTCTTTCTTCTGCAGCGTCTCGTTGAGCTTGCGCACGAGCGTCTTGAGCTGCACGATCTGCTCATCC
TATTCACGCGGAAACGCCAAAAGCAGCCAGTCAATTGATGAAGCAAGCTGGGGGCATACAATTGCGTTTCATCCGGTGGTGTGTACTCACTTTTTCGGCG
ACTTGTTTTTTCACATGACACAGTTCCTCTTTCGTGCGCTCCCATTCTCGCCGCTGCTCTTCAATCTGTAGTATACGATGAAATGTGGGTGTCAGTCCAA
GCACGAGCATGGTGGGGAGATAGTTATTTACCACTAGATGCTCGTAGTTGCTGGGCTTTCCAGGGAGCCTCGCAGCAGCAGCAGTGACACTAAATCTGCC
CATTAAGCCAGGTGAGCATCAAACGTCATGTCATCTTCGCTCGCGTCGTTTCGAGTCCTAGTCGATGTGGACCACGCATTGAAAAAGACGCGAAAAGTCG
CGACGCAATATGCTTTGAACCCGCAGCAAGTCACATTTTGCAGCAGCAGCAACAAGACAAGACATACAATGGGGGAAGCGCCGAGCTGGCAGCACATGTG
GGGTGCCAAGGTCAAGATGCCGTGCGACATGGAGGACGACGTACTCGAGGATGTGATCAAGCACGTCACAGCGCGCCTCGCCAAGTTCGACACGGAGGAG
TGGGAGAAGAAAGGGCTGACGGTGCGTGATGAGGTTGCATTCTGCATATGCGATGCCTGCTAGTCTATCTCATGGCGTGTGCGTGGATTAATGCGCGTAA
CTTTACTCGCATACCTCATGAAGCGTAAGAGGCAGTCTAGCTTTGGCCGGATGCAACGATTGACTGGTTTACAGAGTTACTGATCGCCTGCATCCCTACG
AATATGGTTGCGTGCTATTGCCTACGTATTGTGGTTCTGCTAGGTGTGCGAAGAGCTGAAGGCGCACATGGACACGCTCTGGGAGCCGCATTGGGTGGTG
TGCATCGGTCGGAACTTTGGCTCGTACGTGACGCACGTGACGCGCAACTTTGTGTTCTTTTATTACAACGAAAAGGCCATCATGGTCTACAAAGCAGGGT
GATCATGCGCGTGTGGATATACCATAAGTTATGCGTCTCCATATAGTACATGCGCATATCGTATCGTACAGCGCCGTCCTTAGGCACGCCATTAGGCTAG
GCACTATGTTGCCCACGTTGTTTGATGATGTCTCGTAATTTACACTCTCTTGTGGTCATTTATCGCAACCAATCAAATGGCAATCGGCCCTTTCAATGCA
GCGTAATGTATTTCAAGTCGGTAATTTACGCCCCAACGCTTGTTGCCCAACAGTTTTTCTTGACACACTCGCCGTCAAGGGGTACAAAGCGATTTCGGAC
GAACATGGCGCCCGCAACCAAGAAGCAGCGCGTGAGCGACGATGGCAGCGCCACCGCGTACCCGGCGCCCGAGCTCAGCCACGAGCAGAATGACGACGAG
GAGACTGAGACGGAGGACGAGGAGTCGCCCATGTCCATTATTGCGCAGTTCCAGAGCGAGGACGTACGTCGCATGCGTTGCGCCTCTCTGTTGGGATGGA
TGCAGGACATGTTGATCTAATGGTAATGGCGGTATGCTGTTGTTGTGGGGGGGGGGTGTAGGGCATGAGCGTGGGCCCGCAGTTGGACATCCCGCTGAGC
TCGAATGTGAACCAGATGGAGGTGCTTGTGAACGAGCTGTTGCAGGTACATTGACCACGACTGGATGAATGCGCTTTTGCATGGAGAGCTCATCATTAAT
GCTGCTATTTTTTTCTACTGCTATGGGTGATGGTATGTGCAAAAAAACGTGTAGAATGGAAAGAACAAGGTGCCGTACTCATTGTTTGTGGGTGAGACGG
AAATCACCACGTCGCTTCAAGCCACCGTTGAAGAGCTGGTACGTCCTGATTGCGAGCATGCGCTGCTCTATCACTGTAGGATCCCATTCTAATATGAACG
TATTGCCTTGTTGTGTATAGAAACTATCGACGGAAACGGCGCTGACGATCACGTTCCAGCCACTCGCGGTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCCAGTCACGCGATGCAGTGACACGCTTCAGGGCCACTCAGAGGCGATTCTCCACGTGAGTTTCAGTCCCGATGGCAAGAAGTTGGCGAGCGG
CGGTGGTGACGCGACCGTGCGCTTCTGGGACACCAACACGTGCATGCCGAAGCACACGGGGCGCGGCCACAAGCACCACGTGCTCTGTACGGCGTGGGCT
CCAGACGGAGAGCGCTTTGCGTCGGCGGATCGCAATGGCGAGATTCGCTTGTGGGACCCGAACACGGGCAAGCAAATCGGCCAGCCGCTGAAAGGACACA
AGCAGTGGGTAAACTCGCTGTCGTGGGAGCCAATGCACCGCAATGCGACGTGTGAGCGCTTTGCGAGTGCGTCCAAGGACGGCAGCATCAAGGTGTGGAA
CGCACGCACAGNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGGCGTCGCTTTCGAGCCACACCGACTCCGTTGAGTGCATCAAATGGGGTGGTGAAGGACT
CTTGTACAGTGCGTCGCGCGATCGCACGATCAAGGTGTGGGCCATGGAAGGAGAGAACCTTGGCAAGCTCGTGCGGACGCTGACTGGCCACGGCCACCGA
ATCAACACGTTGGCGCTGAACGTCGACNNNNNNNNNNATCCGGTCCGTTTGACCACACGAACAAGACGTTTGCGTCTCGCGAGGAAATGCAGCAAGCAGC
GCTCGAGCGGTACCAGGCAGTCCGCAAGAACCAGCCAGAACGTCTCGTGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCACGCT
GTTTTTCTGGGAACCAGCTGAGAACAAGAAACCCGTTGAGCGTCTGACTGGGCACCAGCAGCCCGTGAACCACTTATGTTTTTCTCCCGACGGCCGCTAC
TTTGCAAGCGCTTCGTTCGACAAGAAGGTCAAGATCTGGAACGGACAGACCGGCAAGTTTGTCGCGACCTTGAACGGCCACGTCGGCGCTGTGTACCAGG
TGTGCTGGTCGAGCGACTCGCGCTTGATCGTGAGCGCCAGTAAGGACTCGACGGTCAAGGTCTGGGAGCTCGCGGCCCCGAAGAACGCCAAGGTGACACT
CTCGGGCCACGAGGACGAGGTATACGCGCTCGACTGGAGTCCGAATGGCGACAAAGTGGCGTCGGGCAGCAAAGATCGCAAGATCAAGATGTGAGTG