Description :
From Genome Similarity Track
Location :
Scaffold_113:4998- 6204
Sequence
1206 bases(100 bases per row)
CCCCTTCAAGGCCAGACCTACACTCCGCAGAAAGATCGCAGTCCCCGAGAGTCGCTTAGGAAAGATTTTTTCTGCATGTGACCTTTAACCAAACAGAGTT
CGTTTTGCTTCGAAGGGCACAAGTGCTTCTTTCACAGCCTGGAAGGCCGTTCTCCACGACGAAATTCAAAGTACTTTAGGTAAGTGATCCACTGCTTTGG
CCTGGAGGTGATCATATCTATTCCATATCTGTATATTTGGCGGATTACATACCGTCTTTGTTGTATATTTTGCGGTCTATTGGGCCTGTGTCGAACTGAA
GAAGTTGGCGACAGGGTAGATCGTTTCCTCTCTTCGAGAGGTGGTGCGCGTCCCCGAGATTGATCAAGTGTCTTGGATTTGGACCCGTTGACTTGTGTTT
TGGCCTTATCCTTGGGCCTAGAGAAAGAAGAGAGGGCAAAGAAGTATTTGTGTGATTGTATAACGTGTATAACTCTATTTGGGTTGGATTGTTCTAGCGT
TAGCCCGGCGTAGCTGTCTGATTCACGGGGTCGATACTAACCTCCTGGTGAAAAGAACCGCTACCCAAGGGATACACATCGTGCGCCTGACCAACAGCGT
GTACTGGACAACACACACCCTGTGCCAGCCGAGACGGATCCAAAGCTCTAGTAGCCTGAGGTCTGTCAAGGAGGGCCTATAACAGTTTTCTGGGAGAGAA
CACCGCATCGCCTCGTCACATGTTGCCGCTGGCAGCTGCGTCGGGTGGCGCGTCTTGCGCGTCGCTGCCTCGTTCGTCGCTCGGGTTCTGCGTCGCCCGG
TTCGTTTTCCTTCGTCCTCGGCCTCTTTTTGATTTCTTTGTTGCCCAAGATTAGATTCTCCAACAGCTGCGGGAGCCGTCGTCGCCTGATTCTGATCCGT
CGGCTGATTCCTCGTCGCTCGTTTCGGGGTCTGCACGACGACCTCCACAACCTTCGCCCTTGTCATCTGAGCGTCCTCCGGTGTCTTCGTGAGTCGAGGG
CTGCGTCGAATGCCGCGGGTGACAATCGCATCGAGGGTCGAGTTGCGTGGAGTAATCTGGCATAACCGGGCCATTTTTAATTGAGCTTCAGCTTGTGTAA
TGTCCATCCGTGTTGTCAAAGTGTTGCAACGTGTTGTGAGCCCCACACGCTTGGAGTTTGGTCGCGACTGTGGTGAAGCAGTCCGAAGTCCGTCTGGCCG
TCAGTG