Description :
From Genome Similarity Track
Location :
Scaffold_69:49978- 55127
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014664Similar to WRKY19: Probable WRKY transcription factor 19 (Arabidopsis thaliana)

Sequence
5149 bases(100 bases per row)
CCTAGCCATTACATGAAGGTGCGGCTGTGCCCTACTTCAGTGTTGGACACACCACCTTCAGCGTGCATTGTGATAGCAAATAACAAAGCGATAACGGTAC
AACAGATCCCATATGCACGTGTGACATCATCTGATGATGCCACAAGTATCCATGTACTAATCAAGTACAGAGTGATGATTCCGACTTGGGGAAACAACAC
TGGTGATGAGACCAACGTGTCGCTACCATCTGAAGTGAGTGGCTCCCGCCAATCACTTTGCAGGGGATCTTTGCGGTACTTCAAGTTCAAGTTTCCAGCA
GATCCCCTAGTTTCAACCTCAGTATACCCAAGGTTTTATATATCAGATTCATAGGTTTTATTTCTGTATGTGTAGGTTTTAGTTGTAAAACCTCTAGGAT
CCCTAGTGGTGTTTCATATGTAGTGTCAGGAACCATAACAGCATTTTCAATTCAGTTGCAATTTTACCTCCAAGTCCTCAAGTCGTCTTCTCTCCCTCCA
AGTCGGGAGATTGCTTCCTCTAAGCACAAACGTGCTGTGAACAGCGTCCCATTACATGAACCCATAATGCATCTTGAAATATTTGAAGATAGAGAACGTT
CACCAAATAGATTTCGGTGATTGGTCAGAGGCATACACACGGACCCATAGTGACACGTCGGTCTCGTCACCCAGACAGTTTCCCAAGTAGGAACCATCAC
TCTGGACTTGATTAGTACAGAGAACCTCATGACGTCATCAGATGACGTCCTTCGTACATGAGGATGCGCATTGCACGAACAAAAGCACAGGTCTTTGTTC
ATAAAGTACGATTCGAAGGTGGTGTGTGGCACACTAATCTGTGACCAGATCCCATCTTCATGTAATAGCGCGTAGGGCCCATTACATCACCTCGGTGCGT
CGGGCCTCGTTGGCTACCGCTTGAATGCCTGCTGCTTCTTCTTCTGCGCGGAGTAACGATGCATACGCTGAGGGTGCCGCTCTCGAACTTGTGCGAGGTT
ATGTAGTCACAGTTCGGGGATCGCATCGCCTTGAATTCACGCCATTTTTTGACGAAGCCATTGCAAGTCTTGAGACTTTCCGCTTCCGACTACTCTTCGA
AATTGACGTTGAGACTCTCGTTTCTCGTCTCGGACGCCATCCTTCGCTTTGCCTTTGTTGTTCCGCTCCCGATCGCGCAGCGCTGCAATCGGTGGTAAGT
CACTGGACGTTGTTTTGCTCGTGACCTTGGGTGGCGCTTGCGCTGGGGGTTCGCCGCTCTGGTCAACGGTTATGGCTTTGGCCTCGTTTCCTGGTGTTTC
CACTCGACATGCTGTCAGCCTTGCGATAAACTCGCCGCCGTGCCGACTTTTTTACTCGCGTACGCCTTTGCTCAATACCATGTCACATCGTTCAACAGTG
ACCAGTTTTCGGCGATCAAAAGAATGTGCACACGTATACTCTGGAAATCTCACGGTTACATATAACCACTTTCTCAACAACCACATACCTGTGAGTCGGC
TTGCGGCTTGTTGGTACCTGACCACCACTCTTCGTGGTTCACACTTTTGGTAGGGAAGGGAGAAGGGGATGCAACGGGGTTACACACTGGGTTATCCTAT
AGCCAGCGGCATGGAACGAAGTTTGCATGCCCAGCCAAGGTTCGCACTTACGCCACTATCAAACAACCATTTTAGGTCGCACCAATAAGCAGCGACTCTG
CTGTTAATAAGATCCTAAGCTACCGCCAGCTTCCAATCGAACTTATGAGAGTTGACTTCGCTCTCAATAAAGGCTCGGCCTGCTACCGAACCGTAATAGG
TCTAAATGGCGATTCTTTCAACCAGAACACTTAATATCACATGAGCTCCTCAAAGCCATTCAACTAGGTATTGCATGCAATTTAACTGAGTTTTCTAAAA
CTTTATAGTAGAATCTAGATAAGCCAAGGTTGTCCAACAGAGGACAACCACATATAAACGAAGCAGTTGCTTTTCGATTCCGCTGTTGAACATAAATCTC
CTCAAAGTACATTTTGAAAAATCCGTTTGTAGGTATTATTAGCCTCTAAGGAAGCCTTGTTAAAAGGGATTGACATACCCTTCCTCCTTAAACGAATTGT
GCTGCTCAACATGGACGCCGATAGCGCCCGGTTACAGTACACTGATAAACGTACAGTGAATTGTCTCTACTGCCAGCAACCCAGTTGAGAAAGACCAGTG
TAGTAACCGTAATCGAGACACTTTAAAGTGAAATATCTATTGCCAGCAATTGATACACTTGGCTATTTCCCGCTCGCTCTAAGTCAGCGGATATTTGTCA
GCGATATACAAATCAGACGTTTAGTTGCATTTCACTGCACTTCTTATTGTACTTGAGTGTTATTTCATTGCTCGTCGCTGTATCCAATATCAAATAATAT
TTTTACTCTCCCCAATCGACATGAGGAATATAAAAAGCCTACTCTTTATTTATCTACTAGTATTTAAACTACAAAGATCGCACACACCGTCTCTAACGAT
CGATCCGTTGTTGCTTCTTCGCCTATGGTCCCCTTTGAACCACATTTTTAAGCTTGCCCAAACATTCATATGTCAAACCTCGTAGTAATTGACGCCCTGG
AGCTCTTCGTGGTGCTTCACGCAGAAATTCTGAGTTCGCTCGTATCCAGGCTTATTGCATCCGTCGTAAATGCAGCGCTTTCCACCACCGTGGGCCCAAC
AGAATCCATTCGAGACCGCAACTTTATCACAATCATCATTCCCGCACTTGGTCCCACCTCCATGGCCCCAGCACAGTCCTTTCGCCTTGGCTCGCTTAAT
GCAATGCTCGACGCGGCATTCAGTAGATCCTCCTGTTTGTGGCGCATTGCGCGAGTTAAACAATACTCGAATGAGTGATTACGAGGACATATACGTAAGA
ACATATAAACATACAAATGTACCATGCTTCCAACACACGCCTCGATGCTTGGCGCTCGTAGTGCAGTCGGGAACAGAACATTTCTTTCCGCCCTGTACAG
TATGAGTAAAGCCACAATATCATTCCCTGTCAAATGAGACCTTTTAACGACTCACCACACTTACATGTATCTTTTGGTACGTACCCCGTGGCGACAGCAG
AGCCCTTTGTGTACAATGTAGTTCTCGCATCCCTCCGTTCTGCACATGCGTCCTCGCTTTTTCTCTTCCTTACTCCATTCGGCCCTGGGTCGCGTTGTCG
CCTCGGTGGTCTCAGCGGTAGGAGCTGCATGTTGCTGCATAGCAGTCGCCGGTGACGGGGACACATACCGAGTCATGTGTACGTTTGTGTTCAGGATGAA
CGGAAGCGTGAACTTGTGCACGGATCGCGAATCGTCGTCGTCGTCGTCCCGTCCGACTTCTGTCAGCACCGTCATTGTCTGTTGAGGAGGGTCACCCTCG
TGGGTGCGGCCATGTTCCATCGTTGTACGCGCGCGAGCCGTCGACAAGTCCAATCACCAAAAGGCTCGTCAATGCCGACAAAGAACGCGATCTGACTGAC
GGAGCAGTGTGCTGAGTGAGTGAGGGGACCAACACGAGGGGGCTGCTGCCCTGTAACTGATCTCCGGTTGGCTTCGCGAGTCTTGTGAACGTTCGACAAC
CCCACGCTCCACCCATCTTCGGCCAACAAGAGGCTCCGCTTCTCCGGTGCGCGAAACGATTGGATGAAAACGTGTAATAAGTGCCCTTCGTAATCAGAGA
GGTGCAGCCTGCTCGTACGTGTACGTATGACTGTTCCTCTCTATGAGTATCGGGGTGTACACACGCCTTGCAGGAAGCACAGAGACGCGCCCATCTAATA
CACGCATGTACTTAAAAGGTACGCAACACTTCTCCGCAACAGCACACTGTTTCGAAGCGACCAGCGTGTTGAAGTGCCCATGCTGTTGAGAACAAAGATG
CTGCTGTACATTGACGTAGGCAGGGACAGGGACGAGAGGGAAACATAAAACATGCCACACAATCTTCAAGTGAGTATGCAAATCCCAACTGTAGCTGTTT
GAAGTCTATAGTGTCATGCTCGCATCTGCTTCCCCTTGCGCTTGAGAATCCATCCAGCACTTCTTCTCCCCCCGCTATGGCATACGTCAGCGTAATGAGA
GAAAAACAGGTGGTAGGCGCTTTGACACTAAATCCTATCAAATTTAATATTTAATTACTTTCGATGAATTGATTTATGATATAGCCGCAATGGATCATTA
AGTCAGCAATACAGCAAAGAGGGTAAAGTTATAAACCCCTCAGATTAGATCCCTCCAGTAACTATTCAGGGCGCATCCCGTGCAGAACGAGAATTTGCGG
ATGAGAAATAATGAGACTAGGTGTGATGTAAATTTAACCATCACTCCTTTTTCTGTGAACAGACCGCTCATTCTGTTCCAATTCGCTGCTCGCACATGGA
GGCAGATGCCAGACGCCAGATCAGTCTTCTATGATGTGCTCGCTTCATTTACAGAAAATACTGTCCGCACTCTGACGCTACTCAGAGAAGCTGAAGCGAA
CAGAAAGAGTGGTGTGCTGGTGTCTTCTCCAGATATGAGTTTATGCGAGGCACAAGCGCAGTACATGCGCCGAGTCTACACTGTGCGATGTAATGACATG
TTCCGCCGAAAAGAAATGCTTTGTGTGAGGTTTGCAACGTTCGTAGAGCAAGAGCACGCGAGCCCGACAGACAAAAGGCAAAATGCTCGAATGCCTCGAT
GCCTCGAAACGGCGCAGTTGGCTGTTAACACATTTGTAGCGTACAATCTACAAATACGTCAGCATTCGATGCCGCCGCGTCTGCCTCCCGAACAGTTCTG
TGCATACTGATATGAACTTCAAAAAAAATTATTTGCGCGTCTCCCTAGCCAACTCTGTAGGTTTCCAACTCTAGACGTATTGCATACAGACAAGTCCGGC
GCCGATTCTTGAACGCTACTGTTGACTCTGGATTGGAAATGCCCTGAATGCGAGGGAGAGACTTGCCGAATCATCGTGTGCATGGAAAGGCAACAGTGCC
CTCACCGCTTTTTACAAACAAACTTCATTAAATCCTGACACAGCTTGGCTTTCTGAACGACGCATATTTTGCTGTCGATTTATTTGTGTACCTTCTGCTG
CGCTGTCTAGATTAATGGCCGCACAGCTCATTTTTTCGGTGTCCAAACT