Description :
From Genome Similarity Track
Location :
Scaffold_12:499753- 525689
Transcript NameFunction/comments
Phyra_75407N-formimino-L-glutamate deiminase
Phyra_75408glycoside hydrolase, putative
Phyra_75409bzip transcription factor
Phyra_75410bzip transcription factor
Phyra_75411bzip transcription factor
Phyra_71306AF511649_6 unknown

Sequence
25936 bases(100 bases per row)
CAGCTATGAAGCAGTGCTTCCGTACCACATCCTCCATGGGACACCACGTTTGGAGACAACGCGGCCTGTACGAAGTCGAGTTGGTCTCTGGACGGCAGTG
CGTCGGATGCTCCAAAACTGTCAAAGGAAAGTCCGTCACGAAACACTCGAAAGTACGCGACTGCCACGCTCCAAATGCTTGTTTCGAGCGGGATAACGGA
AGGCAGGTCAGGCTGTCGTTGCTCGCGTTGCTGAACCCGTTGCTTGATTTCTTTTCGTAGTTGTTGAGTGTCTTCCTCAAGACTTTTAATGCGATCGCTC
TGCTTCTTTCTGTATCGCCTCTCGTTGACGCGCCGACGTTCACGCTCGCTCTCTTTGGTCATGACTAGCAACTCAGTAATAGATGCATCTGGCGCTTGAA
GTCGTCTCAGCTCGTTCAGTATCATATTCTTGTCAGTCGGGGGGATTCTGCCGACTTGTGGAGTGCTGGTTTCTGGGTGCGAATTGCTTGTCCTCGCAGT
TGGTCGACTTGAAAACACGCGGCCGTGATGTAGATTCTGTTGCTGATTCATTCTGTTAGCGCTAATAGCAACCGGAAGCGAGGCGTGTTGCCTGGCTCGA
GTCTTGACGTTGATGACATCGTCACTCAGAATTCGGTTGTTGAGTGGGTTGAGAACGGAGAAGTCCATTGTGCAGGATTTTGCGGAGCCTTGTGCTCTCG
ACACTGCAAAAGACGAAGTAGCGCTTGGTTTAGAACGCTCAGACAGTACCTGCTGATACAGCGTAATTGCGTGGGACCCGTAATCAAAGATTTGACCTAT
TTGGCGTCGCAATAATCTCGATTTTAGGGGTATTAATACAAGGTTATTGTGCTTTTCAACCTTTTTGCCGCACCCGAAACTCACATGGACCGGCGACAGG
TTCAAGCGCGACGTGCAGATAGTCGTAGGCGCCGACAGCCTCATCCAACCCGTGCAACGCGCCGCCGACGCCGCCGCGTCCGTCCACGACCTCCCGGGCT
GCTCGCTGCTGCCCGGCATGGTGAACACGCGCACTTCCAGCGCTGACTGCGCGGCCTGGGCGAGACGTACCCCCAAGAACTCGGCGCAGATCAGCTTCTG
GACGTGGCGCTAGGAGATTTACAAACTCGTGGGCTGCGTGAGCAAACTGCAGATCTACGACTTGATAGGCCAGTGCTTTTCGGAGGTGCTCGACGCCGGC
GAGTTCCGCTACTTCCACCACGGCCGGCCGGATGAGGGCAAGAACGGACTTGTGTTCGTGTACGATGAGACGGTGCTGCGCGTAACCAAGGACGTGGGCA
TCCGCATCGCGCTGCTGAACGCCTACTACGAGCATGGTTGCTTCCAGCGTTCGCCCATGGTGGAGTCCCAGATCTTCAATGGAGAAGCAACATCAGTGTA
AGCAAACAAGCAGCAGTCCAAGCAGCTGGAGCCTACCAAGTCATGGCAATAACCAGCGCGTGGAAACGGAAGCACACAAGCAGAACCCAAGGACACTGCC
TTAGCACATGCCACAGCATCATGATGACGATCGACGCAAGCACTAGCGAAATGGATGGTGCAGTATCACTTCAGCACAACAACAAAGGAACAAGTACGGG
ATCAAGACACAGCAATGCGATGGCTATACTGGACAAAGGGTTCCAAGCATTCAAGCAACATGAGGATGCAGCAAAAACGTACCTCAGAATTGACAGTGTG
GACAAAACAGTTCAAAAGCACCTCAGAGCCTAGACGGAACACAAGGAAGACAACAGCCCAGAACAACAAATGGACCAAGAACTACATCAGTTTTTTGTCG
TCCAATGGGGAACTCCACCAAAAGCAAGCCTCGAAGCAGTACGTCTATTGGCGAAAGCGCAGACAGCAAAAAAGTACAACCTACGAGACCCACCAGGAAC
ATCACAAGTCCCGCTACCCGCATATCTCCGCCGATTCGAATGCCACGACCAAAAGCAGAGCGCTCCAAGACAGACGAAAGACATCAAGTCGCATCTTACA
TATTACAAGGCTTCTATAGGAAAATAACATAACACCAAATAGAAGGCCAATTATCATCAGGGTGTCGGGTGGGATTGCACGTAGCCTTCTACTACGGCTA
AAACGTCAGGTGGTCAGCGCGTGCTTGGTTGTCGTAGCTGGTGCTCATTGACGATGCCCTTCTTGAGAAACAGCGCATACCAGCGGAGAAGCGTGCGCTG
CTTTGGGCCGAACAGCTCGGACATATACACACTTGAGACGTCGTATACGTGCATAAGGGCCACAGCCCACCATCTAAAGTCGTCCGCGTAGGTCATGGTA
CAGCGACAATTGTGTGAATGGTTTTGGGCGGGCTGAAGCAGGTATGTCACTCATTTATACCGTTCAAAAGCGGCAAAAGGGAAGGTTGTCTCTATTACAG
GGATGCAGTAGCAGAACAAACCTACCCGTTGATACATTTCGGACTTGGTCGTTTGCTATCTCGGAGCTTATCTCTATTTCGGACCCCTATCTCGGGATAC
GAGACCTCAAGTTTGCTAAAATGGATGAAAAGCACAATAAAAGTGAGGTACTATATCCCCTAGTCGTTAACTTGATGCATGCTGTGAAAAGTTTTGAGTA
CAGTCGTCTCAGGAATGGGAACACATTCCAAATGGCCCTGACCCATATGAATCGGTTTCCGATCCAGCACCACTCCTAATGGAGAGTAGAGATATGGGAT
CCATATGGTGTTTTCTAGCGACAGTGTGTAGAGTTTAACTGGGCAGTGCAATTGCGCGGTATCGAGAATGGAAGCGTGAAGTAACTTCAGCTTCGCCCAA
GGGTGTGCTTGCTCTCCGAATACTTCGAAGGAAGTCGCTAGGCTTGAGTGGGAACGTTGTAGTCCAAGGAAATGACATAGTACTTGCCGTTGATATGTAA
TGCCAACTCGTTGGTTGATAGTACTCGGTCCTCACGACGTCGAGCGGAGCGCTGAAGTCGGAATTCAAAGGACGCAACTTTCATTCAGCCAGCCATGATA
TAGGATCAATAGTTCTAGCGCCAGTGGATTGGCCAAAGGCGATGAAACTTTTACACTAGCGTATTCCTATTTGGCCACCAGTACTTCGTTGAGACTTGTA
CTTCGAAGTATAAATCAAACCCCACGAGAAATGTTGGGGAATACCTCGAAGTACTGTACTGTATGTACTTACACGAAAGCAATTTTTAATCTGAAAGCGC
TAGTCTTTTATTTTCTTTATCTAGCTCCTAAATTAACACAGCAGACTTCAGATTGAAATCCCACGGACGGTCTTCATGCACCACGACGAATTCATCTCTT
TACGCTCCGACGTAGTCGGCCACCGAGTGCGGGTTCTAGTCCGGGAAATACTTGGCGAGGGTTCCCTGGATTTGCTCCGGGGTTCATGGTCTTGCTCATG
ATCGTCGTGAACACCTTCGTGGCAAGGGCGACATTCGTCTGCGGATCGATGAAGTTCACTTGAATCGCCTTCTGGAGCTTCTTTTCGGCCACCTCCTTGA
TCTCTAGAGGAGTCTAGCGGTCGACCTCAAGGCAGACATTCTTCCATGCGAGATCGGCAGGAGAATAGCTGGTTAAGACGCGACCCATGGAGTGCTCAGT
GCCTTGGCGAGATGTAAGACTCATCGCAGTATTACCTTCACCAGCAAACCTTCCTCGCAGTTTCTCTGAGTGCTTCTACCTTTCAAGCATTAGAAGCACG
TACAGCTTCTAACATCGGCGTTGCGTTTGTCTCGTCATTGTCTGTAACCGTAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGACGGTAGTGCGTCGGATGCTCCAAACTGTCAAAGGAAAG
CCCGTTGCGAAACACTCGAAAGTACGCGACTGCCACGCTCCAAATGCTGGGTTTCAACGGGATCGCCGGACGCAGCTCAGATTGCCGTTGCTTGAGTTGC
TTGATCTCTTGTCGCAGCTGGTGAGTGTCTCCCTCAAGGCTTTTCATGTGGTCACGCTGCTTCTTTCTGTATCGCTTCTCGTTGACGCGCTGACGCTCAC
GTTCGCTCTCTTTGGTCATGACCAGCAACCCAGTAATAGATACATCTTGCGCTTGAAGTCGTCTCAGCTCGTTCAGTACCATATTCTTGTCAGTCGGGGG
GATTTTGTTGACTTGTGGGGTGCTGGTTTCTGGGTGAGAATATCTTGTCATTGTACTTTGTTGACTCGAAAACCCGCGTAGACTTCTTTGCTGTTCCATT
CTGCTAGCGTTGATAGCAACCGAATACAAGGCATGTTGCCTGGTTCGAGTTTTGACGTTGATGACATCGTCACTCAAAAGTCGGCAGTTGGGCGGTTGAA
AGGTGCTTGAATTCATGGTAGCAGTCGTAACCTTACTCTTGACGTGGTGGAATTGGAAATGGGAATTTTTCCGCCGAAGGATTTATGCAGTTCTGCTAGG
ATTCGTTGCCCGTGGTGGCGTGAAAAGTTCGTCCTTCTATGAAAGTGTCAACAATGATTGCGAACTACATGTAGTAGTAATACAGTACATCTGGTGGACT
TTGCGATGGGTAGCGCTTGTCTGGGGTAAAGAACGCGTCAATTTCCAGAAACATTTTTTTCTGTGGCAAGTACAGGCGCTGACAGACCCTGAGAGGCACA
AGACTCTTGTCTGACCCACTTATCTCTGTGTGGAAGTTCTGGATATAGCTGAAAGAGCCTGAGCTAAAAGCACTTCAACTATCATAATTCGTATGTGGTA
TCCGGTGCATGCTGCGTCAGCACCAGCACGAACCCACCCTTCCCGTGCTACTCCTGTTAATAACGGAAGCTTTCACTGCCGCGTAGCGCATACATTAAAT
GATTTGCTAACAGCGCGNGACTAATCATACGTTTTAAACAGGTCGACCGCAATCGCTCGATAAAAACTCATTCTTACCATTGTGACCTCGCCGAGCAGCT
TTATCTACGTAATGTGGATTATCGCCGCAAGTCTGAGTCAGTGGACTGGGCATGAAGACGAACTGTTGAATTGAATTTGAAGCCTGCTGCGTTGATTTCT
GAATAAAACAAAGAAGTTAAAGCCTCACGTACTTTTAAGTTCAAACTGTTGTTTACTAAGACAACTTAATACCAACTGCAATATTCTACTATTAAGCACA
TTCCTCTTTTTATATTATTCATCTAGGATACTCAAGGTTTAGGGGCGTTCTCAAACACGCAATGCCTACAAAGTGGAGCATCGGTCAGTCATGTCGGAGA
GTTTTTTTGCGCCCTGACGAGTAAATTGGGATAATTTTGTAGAAAGAGTCTTTCTGCTTCAACTACCAGTACTGTAGTGTTCGCAAAAGCACACGTATTG
TTGCTTTTCAAAACTGTTTATTATTATAGTGTACTTACAGCAAATCCGATGCGCTATCGCCACGCAGCGTGCGGCCACAACTTTAACTGAGAATGTGTCT
ACGTGGTCCGTATGGTGGTATTAATATGTTCTGTATGTATTATTCATATTAATAATAACAGTACACGAGCAGAGTTCAAACTATCATTTTACTGTTTTCA
GGTGATTAGAACGATACCAGGAGGGTCCGGTAACGTGCTACGAGTATTGCATTCACCCAAGTGTCGTTCAGATTCGCATTTCATCCCCTCCTCCTCTGCC
TCATACTGTGCTACTAACAATAGTCTTTTATTATTATTAGATACTTTCGAGTGCCCAACATCGCACTCATTCCAGGATTACTTGCCCTATTCAGGACCAT
CGCCGTTGACTTGTCTCGCCACTTATCAACTCGCTGCTGAAGCAGATAAGCGACGACCATGGGCAACCGCAGCAGCGCTATTAACACGACCGACACTCGT
CCTCAGACTCCTGCCAACTGGAATGCCTCGGACATCTCGTCCCAGAAGGACAAGGTCGCCATCGTCACGGGCGCCAACTCGGGTATCGGGTACGAGACAG
CACTCGAACTCGCTCGCACAGGAGCCACCGTCGTTCTCGCCTGCCGCAACGAAACGAGAGGCAAGGAGGCCGAGGCCAAGCTGCGTCAAGCGCTGGCCTC
GACTGTCGACGCTGGCGTTGTTGAGTTCAAGATCCTGGACGTCAGTGACCTCGGCAGTGTGAGCAAGTTCGTGGACGAGTTCAAGGCCACCCACAGTCGA
TTGGATCTGTTGGTCAACAATGCCGGCGTCATGGCGGTGCCCTACAGCAAGACGGTGGACGGTTATGAGCGTCAGTTCGCCACCAATCACTTGGGCCACT
TCGCTCTGACGGCGCAGCTTTTTCCTCTTCTGAAGCAGAGCACGTCGTCTCGAATCGTGAACGTGAGCAGTCTGGCCCACGCTGGTGCCAAGCTTGAGCG
GTTCACGTCCGGATCGGAGATCATGCGCTCGAGCGATGAAGGCTACAAGCAGATGGAGGTGTATTCCGAGTCGAAGATTTGCAATTTGCTCTTCACGTTC
GAGTTAGACCGACGCCTCCGGGCTCGCAAGTTGTCGGGCGTGACTGCAGTGAGCTGCCATCCAGGCTTCACGGACAGCAATCTGGGAGTGGCACCCGCAG
TTGAAAACACGGGCTTGACGGGGTTCCTGTGGCGCATCGGAGCGTACTTGCCGCTTGTTCAGAGCGCTTCCAAGGGCGCCTTGCCCACACTGTACGCTGC
CACAGCAGTGGACGTCGAGGGTGGAGACTACTACGGTCCCAATAACCGGTTTGAGATCTGGGGCCCGCCGAAACGCGTTAATGCTAAGGATACTGCGCAC
GACAAGACTGCGGCGCAAAACCTGTGGAAAGAGAGCGAGCGCCTCGCCAAGCTCAATTTTGACGTAGAGTGATCCTACTCGGATACCTGCTAGGTTTCAC
CTGAGATAGTGAACCTCCTAGCGTGGTATTTGTACAAACTTGAGGCACACGCAAGACAGAAGCAGGCAACAAATCTACTTGCGGCCGCGATGTCGTTGGC
TTTCTAACTGCTTCGGGATAATCTGCATTCATCCGACTTTATATTTCCCTCCTTTCGAGGAACGCGAGCGCCGATCATGGGCAACACCAATAAGTTCTGA
CCAATACTCGTCCTCAAGTACCTGGCAAGTGTGAGACCTCGTCGAAGGACGCCATCACCAGTACTAAACCACTCTTAAGTAGGCTGGTCTACTCAAACGA
ACTGTTGCGACGATGTCACCAACGTCAACTCGAGCCAGACAACACGCCTCGATTAAAGCAGAGCGCGGTTTTACTTACTTTTGCTGTTTTTACGCATGCC
TACCCACGTACGAACGCAAACTCATTACCAAAGAGAAACTATCGATTCTCTTGGATGGCTCAAAGCAGCACATTCGCTGCACCAATTTCCACTCGTCATC
AGCAAACTAAACTGGGCGTTGCGGCAGCTCATGTTGCAGCACGTGCTTTTTAATTGCACCGTTGTCACGAATACTGGACCCGGCCTCGCTAAGAAATTGC
TGCTTGTCTGCCTGAAACAATCGCTTGACAGCTACAACTGCCTCAAACCACTTGGCTCGGTGCACCGAACCAAATGAACCCTCGTCGATGTAATCACCCA
CCTCGATCTCGTACCACGGGACAAACCATCTTGGAACATTGAGCATTTCTTTAGTGTCCCAGCCAATTGCCAAACTGGTACATCAAATCGCGCCAACAAA
TGATCGATCCTGTGATGGAACGCTAAACTGTTGTGTTCAATACCACGCGACGCGATCGTTCTGGAAGCAAGACTTCTTGCCTTTACACGGTCAGCAAGAG
ACCACGTGAAATCCTTTGCAAGGTCTATAACAGCCTTGAGCAGTTCTAGTGGACACTCTCGAAGGCTGCGAAGGTAACTTTGTAGACACTCGAGGCGCTC
AAACACGTGGCGCTCCATTGGGCTAGGGTCACTCTCAATATCGTCCAGCTGGTCCTGAACAGTCTCAAAAATGGATTCAATTGAAGTGTCGTAGTTCGCA
AGCACGTATTCACTAATGCATTCCACAACACGGGGCTCGGAATTGTCATCTCCATTTGCTTTCCCGAGCACACCGAGCTTATTCAATTCGTGAAGGCGAC
TGGATACGCTTACCTTCACGTTCGAGGAACGGTTGTTGGGAGAATCAGTGTTGGATTCGACTACTCTCGCAGAATCTTGGTTGAAACTAAAACCATTTTC
TGATGAAGCATAATTTGAGCTATCATGAACCATGTTTTGGAGAGACTGGACCACATACTCCATACTCGCACGTTCTGCAGGGTTTGCAGAGCACATTTTG
AGCAGGAGGCTCCACAGAGAATTGTCATTCACGTAGCTTGGTCGTTTTGGGAGAACTGTAATTTCCTTAGGTTCACCGATTTGCCATGACCATATATCAT
AGTCTTTCGTGATAATATCGTCCAAAGTTCTCTCAATGCACTAGCCAAACTCCGATACATTCGCTGTCGGTGAGGGGGTTCTCACAACACTTTTACTCCG
TTCTAACCAGGATGTTGCGGCTGAAGAAGCATCGATGAGCGTCACGATGTCCCCACCGAAGATCATTCCTCGGTTGCTAGACGCACTTATGAGCAGATTA
TCGGGTGAAAGACTGGTGTACACCATTCCACGGTCGTGCAAATACGACAAACCTTGAGCGTTTTCAAGGATCAACTCCTATAGAGACCGGTCCGCCAAAT
TCCTATAAGCTCCAGGCAGAGACAAATTCTACAGAATAGTGTCGGTGATACTATTCGCCTCCTCGTAGACGAAAAACGTTGGGAATCCAACATGGCACGC
TCCCAGGAGACGAGCAACGTTTGGATGGTTAAGATCTGACCAAATTGCTGTCTGGCAAACACACATTTCATCGCTTCCTCCAGGTACTTGCATAACGCTT
ACATTAACGTTTTGCCACAGGAGATCACCATTCCGCTCGGTGACTTCATGACGCGGAATGAACCACTTGGGTACCGAGACCACTGTGGAGAACAATGTCA
TCGTAAACTTTGGTGACGACCACGGTCTCCATCGGGGTGTAGACATTCTCGGCGTATTTCTGATAATCATACGCCAGTAACGAGAGCAGTTCTAATGCGT
CGCATCGATGCTGTTTGAACAACGCATCTAGCCCACCTGGAACCACCAAGCTCTTATCAAACACTTCCATGCGCCAGTTTCGTTCTCCCAGCAGTATTGG
ACGCCCATTCTTCAGAACTGAGGTTTCGTGAATACCGTACGTTGCAGTAGCTTCGTCCACCAGAATAACGCAGGCCCATAATTCGCTTCATGACAAATCC
CGTTCGAGCAAAGCGACGGAGCGGGTTACTTTCGTGATTGTACGACTCGCAGAGATCGTCAATCTGCCAGTCGAGGGTTGTCCGTAGTGTCTCCCAGACG
TTTTGTCAGAAATCTCGTCGTATAAATTGCTCAGACGCAACTTGCTATCGTATAATACAGCTCCATCCTGCCGAGCAGCTCGATGACGTGGAATTACCAG
GAGATGGTCCAACGTCACAATAGGCGCGGAGGAGGGAATGGGCTCACCCCCATCAGGGCCCCACCGGTATTACATATTATGTAGTACCGGTTGTAGTGTT
TCCTTCCAGGCTTCATTGCATCTGCCAGGAACTTGCTGGCAAGTCATTGTCAGTCCTAGTGCGGGACTCCAGTAGCTGGAGTGCCTTGCTCCCGGAAAAT
ACATATACTACGTTTATAATAATAACCATTAATCTGCCGTTCAAAGAACTACCAACATTGTTTGGGCCCACCGCGCTACGTGCCTTGAGACGATGCTTTC
GAGTTCAATGTGGTGTATATTGCCGGGGGGCGAAGCTATCGACAGCAGACGTGGAAACCGGGTGAAGTACATTCGAGGAGAGGCCACTTCTTTGTATAGC
CTCTTAGACAATTTAGTGCACGGCTCACTGGGAGCAGTGCTGTTTCAATTGTGCAACGCTCCGATACCGAGCAGACTCAACTGCAGGAGCATCAAACGTG
TCAGCCAATTATCCGGTGCTTCGTGGGGATTCATTCGGGGAAAACGGATAAAACCCCAGGAGACCCAAATGCAACCGTGTGAACTGTCAAAGGTTGTCGC
CTCTAAGCTCGTGCAGCTCCAACAGCTACCACTACACCAGTCAATTATTGGTAGCATGTACACTACAACGAGTTCAGACCTTCACCTCGAGAGGAGCCAC
CGCACCTTTGATCTAGCGAAACCAATCGATCTACTGCGTCACCTCGAGACCGTGGTTGTACCGACCGTGACGCTACTGGTGGGTGGCCAGCGAAAAAATG
GCTCTCGACGACGTTATGATAGTGTTTCGTCGACCATTGCAGCAATTGCAGCGAAGATCGAGCTCTCTTTGCGGGACTGAGTCCGAAACAAATTGACGAC
GAAAGCGACCCCTTGAAAACTCTTTATTCTCAGGTGTTGTCGGCCGCATGCGGGTTCCAGTCCGGGAAGTACTTGGCGATAGTTTCCTTTTAGCTCCGCG
GTTCCGGACAGTCGTCCACGGTCTTGCTCATGATGGCCGCAATATTCATCGTGGCAAGGGCGGCATTCTCCTAGGGATCGATAAAATCCACTTGAATCGC
CTTCTTTTCGACCACCTCCTTGATCAGAGGGGTTTGGCGGCCGCCCTCAAAGTGAATGGATTCCCATGCGAGATTGGCATGAGAGGCGCTAGTTAGGACA
TGACCCATGAGGCGTGCAGTGTCCTAGCGAGATGTGGGACTCATCGCAGTATTGTCTCCACCCGCGACCCGCACGGCGCCTTCCGCGAAGTTGAAGCGCA
GAGAGCTGTCTAGTTAGGAAGTGGCGTAAAATCTTGTTATCTACCCACACGCAGACGTTTCAACGCCATACTACATAAAAGAATGTGGTAAAACTGGTTA
GAACTACAAGACTTGGACGGCATCGATGTGTATAGGAACTCACCTCTGCCGGTACGAAGTGCTTGACACCAGCCGCCTTGGCCGCTCTAGCAATTTCCGC
TTGGCCCATCAAAGCGAGTCCAGCCATCGTTCTTATGCCCGCTGTCAGCTAAAGGTGTTAAATAGACCTCGCTGATCACCATTATCGTATAAGCCGTATT
ACGTTGAACTCTCCGATTTCTTGTCTGAGAGCCACCGCTCGAGTGATTTCCCCGCCGCTGTTCTCCGCTGTCGTCTTCTCCTCTTCGATAAACCTTTCTC
TCACTGAATCTACAGCGCCGTACAGCACACTGTCGGTAGAATGCGCCATGTGCGTCCTTGGACTGCTTCGTGCCGAACGTGCACCAGTAATGATCTTGAC
TCGCACCAAGCAAAGAGTGACGACTAATGGTACAGGACCATCAGACGTTCGGAACGCCAAAATAGTTCCATACCATCCAGCACAAACCTTTGATTACAAG
CTATTACCTGTATTTTTTTTATTGATTGTTGCATGTACCTGTGAATCACGACCATCGCAATCATAGACTATGATTGCGATGGTCGTCCCTGAGTGTTCTA
AACCGAGCGCTACTTCGTCTTTGCCAGTGTCGAGAGCACAAGGCTCCGCAAAATCCTGCACGATGGACATCAACCCGCCCAACAACCGAATTTTGAGTGG
CGATGTCATTAACATCAGGCAACACGTCTCCTTTTCGGTTGCTATCAGCGCTAACAGAATGAATCAGCAACAGAATATACATCACAGCCGCGTGTTTTCA
AGTCGACCAACTGCGAGGACAAGCAATTCGCACCCAGAAACCAGCACTCCACAAGTCGGCAGAATCCCCCCGACTGACAAGAATATGGTACTGAACGAGC
TGAGACGACTTCAAGCGCAAGATGTATCTATTACTGGGTTGCTGGTCATGGGCAAAGAGAGCGAACGTGAGCGTCAGCGCGTCAACGAGAAGCGATACAG
AAAGAAGCAGCGTGACCACATGAAAAACCTTGAGGGAGACACTCACCAGCTGCGACAAGAGATCAAGCAACTCAAGCAACAGCAATCTGAGCTGTGTCCG
GCGATCCCGTTGAAAACCAGCATTTGGAGCGTGGCAGTCGCGTACTTTCGAGTGTTTCGCACCGGGCTTTCCTTTGACAGTTTTGGAGCATCCGACGCAC
TACCGTCCAGAGACCAACTCAACTTCGTACAGGCCGCGTTGTCTCCAAACGTGGTGTCCCATGGAGGATGTGGTGCTGGAGTACTGCTTCATAGATGGAG
GTGCTTTTCGATCTCGTTCCAAAATATCAAGGTGGAACTGGAAGGCTTGCAGAAGGAGAATTCGCATGCTGTGGTCGCCACCACCACGACCTCATTCACA
CTCACGGGGTCAACAGTGCGAAAAATATTCCCCCACCTGTGGAATTTCGATACGGAAGACGGAAACGTAGCGTTGTTGGACAAACTGGTGGGCCAGAACA
TCGTGATGCGTGGCCAGACGCGCTTCGAGTGGGACGGTGTAGGCGGCTACGTGACCAGCGTGATGGCTCAATCCGATTTTCTGACGCCTGTATTTCGACT
GATTGGTGGTTTGGAGGACGTGTCTCGTGTATTTGACAAGTCTCTCATCTCTCCGGATTTCGTCTGGAAAGTATGAGTGGATATCTCGAGGAGAATCGCT
CAATTTGAGCCTCTCTAATAGTTCCGATGTCAGTTTACTGATAGTCCTGCATGAGTTACGGTTACAGACAATGACGAGACAAACGCAACGCCGATGTTAG
AAGGTGTACTTGGTTCTAATGCTTGAAAGGTGGGAGCACTCGGAGAAACTATGAGGTACCGAGAATGAAGTAATTTCAGCTGCATCCAAGTGCTTGCTCT
CCAAATGCTTCGAAGAGGTTGTTAGACGTATTGTAGCCGCATTTTTCCTGAAGGAAATGAGTGGTTGAAGTTTAGACCGTCCACTTGCTTTGATCACTTG
CTCACTTTCAACAAAGTACTTTGAAAATTCTGTATTCGTGGCTCGGAAGCAGACAACAATCAATGCTCGGGTCCAATTGTTCATTTCTGCATCACTCATT
GGGTAGATGAGACCACAGCTACAAACTTTCCAGTAGGTGCAGCATCGATGTTAGCATATCTGACTGACCCGGCCGGAGAATCCGTGATTCGCAAACATTT
CAGTGTCATCTCCTGCAGGGATACACAAAGTCTGAAACCGTGATGCGGTCACAAGTACAGACCCACAAGACTCCTTCTCCCAGCGATAAGCTTAAGAAGC
ACACACCTAACTCCTCAACGGCGCTTCTGGTCCGAATGTAGCATTAACCGATATGCTTGACGCCATTCACGAGCTCATGAAGCATCAGTGAAAGCTGGAA
TTTCTTGATGCATTTGAGCGAGGGCATTGCAGGGGGCCGAAAGCGTAGCAGAAGAGTCGAACGTATCCCGCTGCAACACTCGTTCGGAGATACAGTTATA
CAGAGGCAGCTTGTCATTGTGAGAGCTTCTCGACCTCTTGACGAAATCGTCGACTTTCCTCTCCAAGACGCAGCGCGCAGTTTTCTTTTTTCATGCAGTA
TCGTATTTGCCTCGGTCTCCTAGCCGCTACGTTGTGTCGAGTTGCGTAGTCCTCCCGCAAGGTATTGGGATCCTGACCGATGAACGAGTTGTGAGGCCGC
TCGACACGCTGAGTGGCGCCAGAACTGACTGAATTGCTGGCTGGTGGACGCCGAAAAATGCAGGTGTCCATCGAGAAGGGTTGCAAATACTGAAATAGGA
CGCCGTTAGGAAGGACTAAGTGACTCCAATGTAAACAAGAAAACGAGGATTGCGGAGGGAAAGCTGAAGACCGGTCGCTTGAAGTCAATTGGGCAGAATA
ATAGACCTACATATACCAGCGAAGCGATGCTCTTTACATCTTATTGACGTAGATTAGTACAGGTAGTGGCTACACAAAACTGCCTAAAGGCGTCTATAGA
CAAACATAAACATCAAATAGACGGCCGATTAACATCGAGGTAGTGGCTACACTGTAGGAATGTTTTCCAGATAGGTGAACCCTCGTCTGGCTGTTGGGCG
GCTGCGGCGCAACTCAAACGAACTGCAATCGACTCTAATAGCAATCCAGTACAGGTACCGTATCCAGGGATTGCCAGCCTCAATGCGGGTACATTGTAAA
GAGCCTAACCACCTTCTTTTTGAGTTCGCTCCAGCCATTATGGACAAAGAAATTGTTGTATCCATGGATGTATCACGCTGCAAACACGCTGCAAACTAAG
ATCGGTACACGTACGCAATTTGCAAAGCCCAAAGCAGCTCTTACGTCGCGACAGCAGCGTCCTCGTCCAAATTGGCAAGTTGAACTGGTCCATATTAGTT
AAGAGCAATACACGTGCATGTACCGGTAGTATTATATTTAATAATGCAAACCACTAGACCGGGATAGTCTCCTAGGTGCAGTGAATTGCCTGGCCCTGCA
GAGCTGCACCGTGTATAGATAGTGTGTACACTGCATGCTAACCTGAATCCACGCCGGCTGTCAATATGGAGATCTGGCCTGCAGGCTGTGCAATGAATGC
GTAAACTTCACGGTACAGTGTACTAGTATTTACGCAGGGGCATCTTTACTCAGATGACTTGACCTGTTTCCACTGTGATTGTAGGGTACAGCTTCGCAAC
AGGAGACCTTAGGTACACGTAGGCTCGTCGAAAGCTGGGCACACCGGAAGATACATATCGATCGACCCACCGACGTCGGTGATACGCTCCTCTATCCAAG
CGAACAACAAAAGTAGCCAAGAGCTTGATGAGATACGGTTTAGGGGATTAGTGTGATTTCTCTGTGGTCGATATAACATTGAGCAACCGCGACCAACAAG
TCAAGGGTTCCACTGGAAATCCAGAGTGACGAGAGCTCCTTCAAACACGACGGACACGTCCTCCAAGTTCCCAAGGAGACGTAGCATCGGTGTCAGCATA
TCTGACTGTCCCATGACCCGCTCCACTCGTCTGGATTCGCGATCCCAGAAGAAACGCATCGAGCCACGCATGGCAATCCGCTGACCAAGAAGTTTGTCCG
CTAGCCGCGACCTCGCAGAAGCTCCCGTTGTATCAGCACGCAAGTGTGGAAACACACACTGCAGTGTTTGCTGTGTGATCGTGGCGCTGGTAATTGTTGT
CGCGACAACCGAGTCAAGACCGGCCTTCTCCAAGCCTTCGAGCTCCAGTTCGACGTCTTTGAACCAGAGCGATAAGCTCCTCCAGCTCGTCAGCATTGCC
TCTTGCCCGCTCTCTGAGTTGAAGACGACGTCTGGAGCCACCGTCGATCTCAAGAACCTACCGTACACGCTGGATTGAGCTCCTTGGTCTGCTTGTAGAG
TGGATGTGTGCTGACGAATGCCGTACTGGAAGAGTCGAAAGTATTCCGCTGCAACGCTCCAGGCAGACTCGCCCGCAGACACAACAACATACGCAGCTCG
TCGCTCTTGCGCGAGCTTCTCGATCTCTTCGCGTAATCGTCGAGCTTCCTCTTCAAGATTCAGCGCGTAGTTGTCTTTCTTCTTGCGATATCGTATCTGC
CGCATCCGACGGAGCCCACGAATCCGCTGCTTCTCGGAGAGGACTAGTCTGGCCATGACTGCAAGCTGGTCTTCGTGTTTGGCCAGGACAGTCTTCTCGG
GGACGCCACCGCCAGCAGTAGGAGATGACATCGAGACGGAACTCTGCAAGTGTTCCCTCTTTCCTTTCTGGTCTGTGAACGCCATGCATGTAGAGTTGTT
CTGAGGCGAGGTGGCCCGCCAACGTCCTGGAGGAGCATTCAGCGGAGAGGCTCCCGTCTCTTCATGTTCACGTGTCGGGTACGAATTTCTGTCGGGTGTG
TGCGCGTCCGAGTGTTGCGCTGGGTGGTATTCAGCGTCCGGACTCAAGACGTTGGCGACGGCGACGAGCGAGTTCCGAATGCTCCGGGAGCGCTGGACGA
CTCCTATAATGACATCGTCGCTGAATTGCTGACTGTTGGGTGGGCGGAGAACACACATGTCCATGGAGACTGTCACTTGATGGAGGGGGGGGGCGTGCTC
AAGGCTGGTGAAAGACGAAAGTGGTCTTCGAAATCCAGTGGAACGGTAAAAATGACGGGAAGAACTCTTTCTGTCAGCGAAGTCTCTCCTCTGGAATACA
ACAGGGATAACTTCGAAATCATTGATGGCAATTTGCCATTGGCAAATCCATTGAGCGGAATCGGGAGGATGGATGTCATGATCCGTCAATTAACATAATC
CAATCTGTCAACCTGGAACACCCCGCCCCCCCCCCCCCCTGCATCTGTTATAATAGACAATGGTGCGGGTGCAAATGTCAAGTAAACCAGATTGTGGTAA
TAATCCCTCTTCCCAGCACAACTGTTTATGGGGCCTGCACAAACAAACAGTAATACTGAGTGCCATAGTGCTGGATAGTCTCGCCCAGCAGCCCGGCTTA
TATTTCGTGGAATATGTATAGGATCAGCTCATCCTCATTCTCATCGCCTGCATGTGAACCGCTTGCAAGCGAGCATGTACTGCAACCCCAGCGTAGTGAT
CTACAGGCCTATAATACGCTCTCAACAGGAATATGATGCGCACTACAAGCGCGACAGCATTGTAATGACTGACAGCCACACATTCAACAAACCGACAGCA
CGATAGCTTGGGGCTGCTGTGACCTGAAACATAATGACAACATGATTGTCGAATTATGGCTCATACCGTGCCATGTATGTGGTACACCCTGCGATAGGGA
TTCCCCTCAAACTGAAAGGTTTCTATGACGATCAGCTTCATTTGAGAATCATCTCCTAATTAATAGCAAATCAGGACGTTTGAAGTTGTTATAACACCTC
GTTAGGCGCTATCAAAGGAAATCAAAAAAGTGCTTATGCAGAGTGTTTGTGCCTTCGTGTCATGCTCGCCCCCTTTGTACAGCGTAAAAATAAGCCAAAT
TTGGCACAATCGAAACTTTAGTATACAAAGATAAATATTTAGGCTCCAGACACGATACAGGGGCAAAATGGTGGTGCACAAATGTAACGCAAACGTTGGC
AGATTAGTCACGATAGCTTACAGCTGGTGGTGCCTCGAGAGTAGACTCTCGCATGTACTGTATTGTACATGGTGGGCTCCTGCCGAGAACATGTAGGACA
AGTAAAGCTGGGAAAGTTGTAAGGCAAGATTGCTCTCTGAACATGTACCACCTGCTTTCCACCATCCAGTCCTTTGCCAGCATAGGTGATGCAACATAGA
CACTGCCTCGATTTCCTACCCAGATTACGCGGTGTAGCGATTACGATGGCAACCAGCCGACATTTGCAGAGGAAGGTCTGGGAAAAAACTACGATAAGGG
TTGCAAGCAGCATGTGCTAGAGCCGTGACAGTTTTTATGGTGCATGCAGAGAGAGACGTGTGCGTGCGGTTACATGTACCGCAACCGCACTGAGGATTTT
CGAGGAATCTCCATAAAGAATTGGAGGAATTACCATAAATCCACCTTAAGAACTGAGAACTGTATTTTTCGGGTGGTGACCGTTGAATGTTTCATAGCAT
GACTTGCTTGCTGCTCGAAGCACAATATTATACTACAGATGTCCCCGGCAAATGTGCAACTGCAAGCAGCAATTTACCTCGCACAGGTAGAACAGATGTG
CATGGGATTTGAAACTGTTCGGGATGGGATGTACTGAGGTAGATGCAATGTGGAGGGAAAATGTCGCGATGCGGGAAGCTTCTAGCACATGGAAACAATA
AATTCAGAGTAACTTAGTACGTTTGCATCTGTATGGCACCTGTGCGAATCTTGCAACCTCGCAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNACAAAAAACATTAGAAATTCGCAGCCAGTTCCAGCATCTTCAGTGCACAAAGCTGTAGGGTCATTCTTGTCGATCATCGACCGA
CTCTCGCATCTAGGAAGTCCATGCAACGAAAAGGCTCGGCAAGCGCATGTCAAACAATGCTATGTGTACGCTTTGCTAGGAACCAAATGAATTGCGAGAG
TCGGTCAATAGTCGACAAGAGTGGCTCTACAGCTTTGTGCACTGAAGATGTCGGATTGTTCGAATGCAATTGGCTCTCCGAGCTAGCCAGAACGCTGGTC
CAGCTGACCGAATGCCACCGGAAAAAGCGGATACTAGTCCACCAAAAGAGCTGTGATTCATATCAGTATGTCTACCTAACTTTGCTCTGCTACTCTCCTC
ACTGGCGGCCGACTCCTTGACGCGCAGCAGTGTTTTGACTCCGATACGGAGCTAGCGAGATCAGAGACTTCTCAAACACTCGGGACACGCCTTCCAAGCT
TCCTAGCAGCCGCAGCATGGGCGTGAGCATGTCAGACTCACTAATCACACTCGTCACGCGACCGTAGCCGCTGTCCCACTCGAACCGCGTCGAACCACGC
ATAGTGATGGTCTTTCCGTAGAGCTTCTTGACCAGCTCAAGCCCAGCCGCCCCCGAATCTTTACTGCACAGGTGCGGGAACACGGTGACAAGCGCCCGCT
TGTTAATGGTGAGTTTGGTTGTCGTCTTGGCGATCAGCGCGTCGACGCCGCACTTTTTTAAGCCGTCCAGCTCGACCTCGACGTCCTGAAACCACAGCGA
CAAGTACTTCCAGTTCGTCATGATCGAGTCGATGCCGCGTCCAGCGTTGTACATGACGTCTGGGGCCATGGCCGCTCGCAGGAAGTCCAATTGAGCGCAC
GGCTGAGGCTCTGACGAGTTGGCCGCTTGCTCCGACAAGTCCGAGGCGCGCAGACCGTAGCGAAACAGGCGGAAGTACTCGACCGCCACGTTCCAGAGCG
TCTTCTCGCTTGGGACAGCAGCAGAGACCGATCGTCGACGCTGCTCCAGCTTGTCAATCTCCTGTCGCAGCTGGTGGGTCTCTTCCTCAAGGGTGTTCGC
GTAGTTCTCTTTCTTCTTCCTGTACCGAATTTGGCGCAGTCGACGGATCTCCCGTTGATGTTCCTGCTGTGCCATGAGCCACTCCGTGCTGACGTGTTGG
TTGTTACTTGTACCAGGACCACCTTCCGCCGCGCCACTGGAAACTGCCAAGAGCATCAGCGTGGAGTCGGTGGACTCCTGCCGTTTCCTCTTCCTGTCCA
TGGGTCCTTCTGCCGAGTTGTGTTCCGGTGTTGTGTAGTACGCGTGAGTTGGGTGGGGGTACCCCATCGCCACGTGCTCGGTGGGATACGTCGGTCGACT
GGGCTGCTCGACATGAGCGTACGACCGAAAGCCGCGGGGGCGCTGCGCCGCACCGCTGATAATGTCGTCACTTAGGACCTTGCGGGTAGGCGGGCGGAGA
AGGCACGTGTCCATTTCCGTGCTCTTAGTACAACTGAGTGGTGATGCCGAGGCGAGTTGAGGAATGAGAAGTCCAGTCCAGAACGCTTGCTCTCTCTGGT
TCACGCGCGCACATATTTCACATAAAGCCGTAAACACGGTGGGAAGACTCAAAACAGACGCGGATCGTCACGTTTGTGCAGAATCTCTAATCCTGGGCTG
TGCTTTCGGCAGAGGCCATACTTTAACGAAGTTAAAGAACTTGCACAGCATTCTGCGAGCGGCGTTCTCAACCGGAATGACGAGCGAGCAGATGAATTAT
CCTGCGCGATGGTGATCGCGTGAATTTCATGGATTCACCGCGAACAAGCGGGTGCGTCAGCTAAAAACAAACCTAAAGGACATCGAGCCAACGGAAGTGA
ACTCAATCGCCGAACAGTGCACTTCACTCGCGAGAAGGCTTTAACGTTATCTCCATACCGCGGCGAACAGCGGGACACCGAAGCAGCCTCAGGCTATGGT
CCTCATTACATTTAGAGCATCGCTGCTAATCATTTTTGCAAATCACTTTGTCTATGAGATTATCACAGCATGTTGGTAGATGCACTAAGTAAGTACATTT
TACTGGGAGGTAGTTAGCGAGCTGGCTACCGAACTCAACGGGACCGACATTCGAGCGACAAGTACGAAACACATGCATCTATATGAACGATTGAAGTGTC
AGCTTTCTCTTTAGTTTGTATGGGTAAAAAGACCTTTCACCAGGTACATGTAGCGTGTACTGGTATTCTTACGCCAACATTGATTCAGCTGGATGGATAT
TAATAGTGGAAGCCACGCACAAACATAGATGGCAAGTGAACGTATCAATGAAATGGTTGCTCCACATCATCCTGATACCATCGTGTCTCTGATGTCCCAC
CTTTAAATACCCAAAGGCACACCAAGTAAATCTCCCAGCCTAACCATCGGAATCTAGCAATACTACTGGTTTTCTCTGACTTCTTTAGCGCATGAATTCT
GCTACTATACTGCAAAATTGCATTCTTCGGGCATGAAGAGATAGTCGTAATACCTTGTCACGCTTTACCCGAGAATCAGCATCACGAGTGCCTGCAGGCA
GAGTAGAGTCCGCGCGCTACCGATAGTCTTAGGTTTCAGCTAAACGTTATCTGCAATGATACGAGCTGAGGTCTCCATGGACAGGAGCTTCGTGAGAGGA
AATCTCTTGGCGCTATTACATGTATAGCATGTCCGACACAAAGCCCCCGCTTCTTTCCGAGAGCCAGTAATAGTCTAGCCGCTAGCTGCTTATTACCCCG
GTACAGTGTAGCTTCACACAGCAGTCTGGTTATATGACAGCACACTCACCTTCATGTCCACGAAACGTATCGATCTTCTTATACGTTGCAGAAACCAACT
TACGTTTGAGAATCTACTTATTCCTTGGCAACAACACTATTATACTACGCGTACGTGCAGCTCGTCGCTCGCACAACCACGCTGGATTTATACGAGTGGC
GTGGAGGGGTCAGGGACAGCTCAGTCAGTTGTCCCCGTGAACCGAACGTGTCTGTCACACAGACATTACAACTCGTAATCTACACTGTACAAGCCGAGCT
TCTACATGTACAGTAGAGCACATCGAGGTTTCTCATCATTGTTTCCCCGAAGAAGCAGATGGCGCCGGTCCATCGTCTCGAGGTATGTAGGCGCAGGCGA
GCGGATCCAAATTGAACACGCTCCGTTGATCGGAACGTCATTTTGCGATCCACGTATTCCTGACTCAGTGATGGACGCCTGCGTCCTCCGCCCGCCAAAC
AGCCATTTTCTCAGTGACGACATCGTCCGTGGTGCAGTGCTGCGGCCCAAGCGAACGGAGCGAGGTGGAGTCGCCAACATGGACAACTGGTTTATTGCCG
ACACTGAGTTGACTCGAATTCGTGATGGACATTGGTCTTCTGGTTCACTTGGACACGCCATTGGCGGTGGCGTTTCACGGACGGGCAATGGAAGGAGGCA
GTTGTCGTTGAAGGATGGAGCCTCGGTGAATGAAAGCGACGTGGCGGAACAAATCACCAGCGAGAGGTGGCGGGTTCGAGAAATGCGTCGAATGAGGCAG
ATCCGGTACCGGAAGAAGAAAGAAAACCACGCGAATACTGTGGAAGAGGAAGCTCGGGGGCTACGAGAGGAGGTGGAGAAGCTGCAACAGCGTCGTCGGT
CGGCGTCAGCAGCGACCTCGGCAAAGGAAAGTGTCTGGAACGTGGCAACCGAGTACTTTCGGCTCTTCCGCTATGGTCTCCAATCGACAGCGACACATTC
TTCAGCAAACGAGCCCTCTGTGCAGCAAGATTTCTTACTGACTGTGATGGCAGCAGATGTGGTTTTCAGCGCAGGATCCGGCCCAGAGTCAATGGCAAAG
AGCTGGAAATGCTTGTCAATGTGGTTTCAAGACGTGGAGCTCGAGCTTGAAGACATGCACAAAGGTGCTGCAGACTCGCTGGTCACAAGTACCACAACAA
GTGTCACCATTACTGAGCGAACCCTGCGCAACGTGTTCCCACACCTGTCAAGGGGTGGAGAAGCAGCTCTCGCGGAAAAGCTGCTGAACCAAAGGATAGT
CATGCGCGGCGTTACGCGCTTTGAGTGGGATGCCGCGTACGGCCGAGTGAAGGGCGTCTTCAGTCAGGCCGACATGCTGACTCCAATGCTGCGCCTTCTG
GGCAATTTGGAGGACGTCTCGTGCGTGTTTGACAAGGCTCTCATCACTCCTGACTTTCAGTGGAGGTCTCAAGTCCTGACGTGGTAGTTTTAATCAGATT
CAACGAAGAGCACGTCGTTCATATACACTCCTTTCTCTTGCTCTACTAACACCACCGCTCAGGTGCTGCTGCCTTGGCTGCTTGTTGCTTGTATCGAAGC
TATAGCAGCCCAATACACGGTGAAGGATATGCAACGCTCGAGTACTGTCTACAATCCTCGCGGGGTCGACTCGAACAGGACACTCGTAGCCTGGCCCACT
GCTCGCTCAGTCGCATCAGATCCCGCTAGAGTGCACACAACGCACCACGTTCAGTGTGCAAGCCTAAGCTGGAAGTCGGGGGAAATGGGTGACCCCTCGA
ACACTTGTGCGACGTCCTCCAAATTCCCCAGCAGAGCAAGCATCGGCGTTAGCATGTCGTACGCACTCGCCACACGCGCTATCCGACCGAACGCAGTGTC
CCATTCAAACCGCACCGAGCCGTGCATGGCAACCCGTTGCCCAAGAAGTTTGTCGGCAAGCTCACGACTGGCACTTCTAGTCCCCCATACGTGAGGGAAA
ACGGTGCGCAGCGTTCGCTCCGTGATGGTAGCGCTCAGTGTAGCAGCGGCGGTTAGAGTCCCCGAAGCAGTCCCCTTGTTCAAGCCCCCCACCTCCAGCT
CGATGTCCTGGAACCACAATGAGATCCGCTGCCAGCTCCTGATCACTGCGTCTTCACCACAGCCTGAATTGGATACGACGTCGGGGGCCATGGATGCTCG
CACGAAGTCCAGCTGAATGCAAGGCTGAGCTGTCATCGAAGCCTCTGCAGATGACTCCGATACTTGGAGGCCGTTGTGGAAGACCCGGAAGTACTCGATC
GCAGCACTCCACACGCTCTCTTTCGGCGGAGTGACTGTTGACAGAGCTCGCTTCCGCTGCTTGAGCTTGTCAATGTCTTGATTCAGCTGGCGAACGTCCT
CCCCAAGGTGTATGATCGTGTCCATCTTCTTCTTGCGGTATCGAATTTGCCTCGTGCGACGAAGTGCTCGCAGGAACGTTTTCTGGGCGACATCAAGCTC
TATCATGGCCGCGTCTTGCGTGTTGCTTCCTGAAGCTTGTGGATGTTTGGCCAGGACAGCAGAACTTGCATTCGATGGCACGGCCGATTGAGCTCTTGTC
TTCTTCTGACACTTTCTGGGCCGGCCGTGGGTCTGAGAAGGAGTAGCGTCGGCATCCAACATGACGTACGTGCCAGCAACGGATTTCCTCCGAGCTGATT
CCGCCCGCTGCACCACTTCGCCGATGACATTGTCGCTCAGGTGCAAACTGTTGGGCGGGTGGAGAACGCAGCTGTCCATTGTACGTGCCGGTGGTTGTCG
GCTTGAGCTGAGTGTTGAAAATGACGAGCGACTCAGTGATTCGTGGCAACGATGCTGAGGGGATAAACGCGTGTAGATTACGCAAAGTGTCATCCGATGA
CGTGCGCTTACGTAGCATCTGTTCGCAGCAAGCTTTGCCTTCTCGAGATCCCTCTGCCCAGCCAACACTACACAAACCTGCATTGTCAAAGATCAACAGC
ACGCACTCACGTACGGAATCGTATAGATCGGTCTGCTAGACCAGCAGCGACGTGACCAGCCCATTGCCGTAGGATCTGTCGATCTGCACGACACCATTGG
CCACCAACGAGTACAGCGCGCGAATGACCACGCCGTTCCCGTTGGGCTTGCCGTGGGCCTGCAGCACCGCACTCGCCTCCTGCTTGAGCTCGTTCACGCC
CATCTCGCCTTCGTGTTCGTACAGCAAATGCAGCAGCACCGCCTCTTCCCGCAGCGTGGGCGGGTTGGTGTCCCGCGCCGTCAGGAGCTGCACGTCGACC
ATGTGTCTCATCTTCCTCTTGCGTCGTGCCAGCTCGAGCCGCAGCGAGTCCACCTGCGCCTGCACTCTGGATCGCTCCGTCTTGGCTTCCATCAGTTCGT
CCTTCAACGCCGGCAAGTCCCTCGCGTTCTCCTCCTGCTCCTCCTCCAGTTCCTCGGCCGCGATGATGTGTCTCTGAAGCGCCTCCTTCTCGTCTCTCAA
CTCCCCGAGCACCTGTTCCCTGGCCACCGCGGCCGCATCAGCCCGCACGTCGCCACTCAGCACCTGCGTCTTCTCCTTCTCTGCAGTAACAGCAGCGTTC
TTCCTGGCCTTCTTCCTCTGCAGCGAGTCCACCGCCGCCTCGATGTCCCGCTTCTCCTCTGCACGCAGTGCCACGGCCTCCTGCAGCTCTGCGACCTCCA
CCTCCGTCTCCTCTTCCTCCTCCTGCGCCTCGTCTC