Description :
From Genome Similarity Track
Location :
contig_126:49960- 52888
Transcript NameFunction/comments
g11491.t1hypothetical protein PHYSODRAFT_338978
g11492.t1hypothetical protein PHYSODRAFT_510782

Sequence
2928 bases(100 bases per row)
ACCACGTGCTGAGTCTCTACGGCCGCACCAAGAAGCACCTGCAGAAGCTCTTCCCCGACCCGAGCGACAGCGAGATCGAGTGGCTGCGACTGCGCACCAA
GATGCACGAGATGATCATCGCCCAGCACCTGCGCTTCACTCTAGTGGTGCTGCAGCAAGCCGAGGCGACGGATATCGCCCCAGAACCGGTTGGGCGTGGA
CCCGTGGAGGAGACGGCCAACGGATCGAAGGAGGAAGAGAAACCAGTAGCTGCTACGTGATCCTAGAAAGGAGAGGCGAGCTGACTCGTGGCACTGCGTG
GGCCCAGCAGAGTGAAGGTCGTACTACAAGTCGTACTACTTGAAGTTGAAATCGCAACGACGTAGCGTGTTTACTTAAGAACCGGACCGGACTGAGTTTG
TTTTCAAGCTGCAGCTGGTGACGGTGGATGTTGGACACAGGGTCGGCGTTGGACACTGGTGCCAGTGGCAGCGTACAGACTCACAATCGACGCAAGAAGA
TTAAGATAGGCTGTCCAGCCAGCGGTTAATCTTGGTTCATCTTAAAGTTTGGAACCTCATGGTTCTGATGATCCAGTGGGGTGGTTGCTCCGTCACTTGG
TGGTTTGTGGTGGCCTACACGTTGGCGCTCGCTGGTGCTGTCAATTGATACCCACCACATCGCACCAAGGCGTTTTGCGTGCGTGCGTGTTGCTGCTGGA
AAAGAAACGCCGTTTCTGGACAGCTCTGGATTATAGGTATATGAATGTTGTAGGTGTCGACAGCCCGTCTCAAAAATCGTGGCGTGGCGTGGCTCTCTTA
CTCAGAGTCTGACCATCGCACCGATCCACGCGGTAAAGCTCAACTCTTGTCTGCACACTGTACTAACAAAACCCTTACCGCCACACCACCAGACCTTACC
ACACACATTGCAACTGCCAAACCGCTGCACTTAATTAAGCTGATGTTTCTGCCGTTCCCCGGCTCAAAACATGCGATTGCGAAGCCTTCCACCAGCGCTT
CGAGTTATCATCAACGGCCCGTGATACCCACACCGACCGACTCGACTCGCCCGCCCTCCACAATAGCACCAATAGATAGCACTTCTAAATTTGCTGTTCG
AGCAGCAAAAGCCTCTTCCGACTCACACCTTCGCCAACCGCTATGGGCTTCTTCGACGAACAAGTGGGCGTCAAGGTGCCCCAGGTCACTGTCTACTTCT
GGATCATCAAGGTCCTGGCCACGACGGTCGGTGAGACGTTCGCCGACTTTCTCAACGGAAATGTTGGTCTCGGTCTGGGCGGCACCTCCGGCACCATGCT
CGCCATCCTCTTGGTGGCACTCGCGGCCCAACTGAAGCTCGACTTCTACTTCCCGCCGCTCTACTGGTTCGTCATCGTCGCCATCAGCACTGTGGGCACT
CTGCTAAGCGACAACCTCACGGACAACCTCGGCGTTTCGCTGTCGGTGACCACCCCCATCTTCCTCAGTCTGCTGGGGGTTGTGTTCCTGGCATGGTACC
ATTCCGAGAAGAACTTGTCCATCCACAGTATCTTCACGCGGCGTCGGGAGGCGTGGTACTGGCTGACCGTGCTCGTCACCTTTGCGTTGGGGACGTCGGC
GGGAGATCTCATCGCAGAGAAGCTCGACGTTGGCTACGGAAACTCGTTGGTCCTCTTTGCAGGTTGCATCCTGTTCGTGGGGTTACTATGGCGGTTCAAG
GTGATCAACGGGGTGCTCGGCTTCTGGGTGGTGTACGTGCTGACTCGGCCGCTCGGAGCCTCGCTGGGAGACTTGATGTCACAGAACCCGGCGGACTCGG
TGGCCTCGGCTTCGAGCTCCGGGTCGGGCTCATCATCGGCTTCGGCTTCAGCTTCAGCCTCCGAGTCGATGTCTGGGTCTGGCGAGACGGAGGAGCTCCC
TTCCGGTTGGAAGACCGGCCTCAACCTCGGCACGACGGTCACGAGTATGATCTTCTTGGCTCTCATCGCAGTGTTGGTGGCTTTCTTAACCATCACGAAG
AAGGACGAGCTGAAGGTCGAGTCTATTCACCCTGATCTCGAGAAAGGGGAGGAGCCAGGGGCTACCTCGACCACTTCAGTTCAACACGAGTGGACGACGC
TACCCGACAATGCAGCGCGGTAGACTGTCTTTCAAACTGTGAAGGTACTTTCCCACTAAGACCAATGCGTCGAATCTCAAAACCTACAACACCACCCTGT
GCATTTGAAACTTGCTTCGTTATACACAATATCAATACGTCGAAAAGAAAGCAAACGAAGTGTATACTTCGTTTATACGCATACTGCGTTGAGGATTGTT
TTGCTATGAATACGTTTGGCATACATGTCCCCGCCTACTCCACACGAGTGATCGGTGCCGACGGGAGCTCGCTCTTCCTCGAGCGCTTGCGCTTGCGCAG
GAAGAAGGTTTTGAGGTCGTGTTAAGTAGTAGTTTGAAGTACTACAGCAGCGTACATGGTCATGTTTGTAATAAAAGGAGTTAAAACCCTTGACCAAATT
CGTGATCAATTTCAAACTGCCGCTTGCGAAGCCTGGACAATCGTCAACAACAGACAAACCTCTAGCTGGATCTGAAGTGCTGGGTGACAAGGGAGCTATT
TAAGCTACAACAATATAATATATAATATAATTATTGGACGCTCCGCTTGTGTAGCAGAGTGAAGGTCGTACAAGTTGAAGTTACAGTGCAGTAAGGTGTT
TACTTCTGGGTATTTTTTTCTAGTTGCAGCTGTAGAGCGACGTTGGACACAGATGCCAGCGTAACATCCTTTGGTTCACAATCGGCGCCAGCGCAATCGC
ATTTCACGTCTGCACTCAAGTGTCCTAACCCTTTTGCATCGTATTCTACGAACAAACAGGGAAAATGGAGTCTTCCTGACAATATGGATAGGAACAAGTC
GTGTTGTTACGCATCGATGTCCAGCCAT