Description :
From Genome Similarity Track
Location :
Scaffold_492:4996- 9761
Sequence
4765 bases(100 bases per row)
CTTGGAGATGCTTGAGCAAGTGATTTCTTCACCAACAGAAGTCCCGTACTGGTGATAAGATCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATC
TTACATGGCAGTTCAATCGTGTATGCGTTGCCTAGCGGCGCAGTACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCATGTTAGTCAC
TATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTTACCTTCATTGAATGAAAGAACATTTGCCGTTCCATTCTTGTCTACGTTTTTCTTTTGT
CGGTCCACTGCTTCAGCAATGGAATCTTGCACGAAACGGACAACCGTTTCGCGAGCCAGTATAAATTCATTCGCTGACTCGCTGTCTTTAGCTGTAGTGC
GCTTGGAGCTCACTGTGGCAAGATCAGTGACCTGGGTAGTAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGT
GTCATACGTAGTGACTTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCATTCGCTCGAATGATTCCCTCTGCCCTCAAACTAGACTTATACTCTA
AGAACGTGAATAGGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCAAATTCCACCATTGG
CGAGAATTCGCTCCAATTCTTAAACAAATGGACATAACCCCTAAGGATTTCCTCAAGAATGCGGTTTGCACGTTCTGTCTGACCGTCTGTTTCAGGATGG
TCAGAGGTCGACATCTGAAGGCACGTTCCGGGTGTTTTGAACACGGATCGCTAGAATTCTGCAGTAAATCGTGGGTCTCGATCACGTTCAAGAATACCTG
TATTCTTATGTGGGTCTGCGGGGAATCCAACGACAAAGTCCATTGAGACTGATTCCCAGCATTCTGCCGGAATAGGCAAGGGTTGCAACGGCGCACGAAG
TGAAGGACCAGACTTCACTCGTTGACATACTTCGCATGCGCGGACGTACTTTCGCACGAGTTGATACTGGCGGGGCCAGTAAAAGTCACGACTAACTGTG
AGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTCATACATGATGTGCAGTCGCAGGTCACCATGGTCCGGTACGACGACAC
GAGGCGTGTCGCCGGCAACGGCTGTAGACTTCAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGATTGATATACTGGGGGCAACCTTTTAAGGGA
TTGACGGGATGTTTGCGAGACATGTTTCATCAAACGCACCATCGCCGGATAGTACGCCATGCGTATGTCTTCTAGTAAGGTTGACGACGGGACACTCGAT
GTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCAAAATCGGGCCGGCGCGTCAGAGCATCAGCGACGACATTCAGCCGTCCTG
GTTTATATTCCACGGAGAAGTTATACTCCGCGAAGAACGACAGCCACCCCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGC
ATGGTCCGTGTATACGATGAAGGGTCTACCAACTAGTAGGTAGACCCTGAATTTTGCCAAAGCATACTTCATGGCAAGGCGTTCCTTGTCATAGACTGGG
TAGTTACGTTCAGCCGGTTGCATCTGACGTGACTGATAGCAGACGACACGCTCAACACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAAT
CACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAAGAGCGCTG
GAAATCAGCACTCCATGCTCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTTGGCGTAATTGTGCGAATATTTGTGCAAATACGCC
ACTAGGCCAAGGAACTTTTGAAGTCCTTTTATTTGAGTTGATTTATTTTTTGAAAAGATTGAAAAGTTATTCTTAAAAAATACATATTTAGGCACCGGCC
AGTCAGTGATCACCTTGATCTTTTCCGAATGGGGCCGGACGCCGTGCTTGCCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATACACTT
CTTGAGGTTGGCGTACAACTTGTGCTCACGCATCAGTAAAAGAATCTTTTGTACGTGAAGTCGGTGTACTTCCAAATCCATCTGTCCATCCATAGCCCGG
CTATGGACGAACACGTCATCAAAACAGCTGGGTGCGAATTCTCGCACAGATTTCAACAGATTCGTAACACATCTGTTGAACGTAGCAGGGGCATTACTCA
GACCTTGTGGCATTACTAGCCACTCCCAAAGCATACTGCTTGGGGTTCTCACTGCTGTATAATGAATTTCCTTTTCACGCATAAGGATCTGATAGAACCC
GTCATCAGATCCATCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCAT
TCAACTTGTTGAAGGCATGTACTGTCCGCCATCCTCCTGTGGCCTTTCGGACACAGAAGTTTGGAGAGAGATGTGAAGAAGTAGATTCCCTCACATGGCC
CGCTGCCAATCGATCAGCAAAGAATTTGTCAATAGCTAGTACTTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTTGAACCTGGTTTCAGG
TCGATCTCGTGACAAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTCTGGGAACACATCCCTGAATTCCATCGAATAATCGTAGAGAGGATTTA
TCTTGAGCGATTCCCACGATTGGGATGTATATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGTT
CTTAGCGAATATTTCCAAACGAATATCGGTTACGTACTCATCTTCCGCGACGATTACGCAAATCTGATTGACTTTGCCACTACGCAGATCACGCAAGAAC
CTTTTCTGTTCGAGCGTGGGCAATTGAATTATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAATTTGGTATGTTCCTATGCTTGATCCTTCATTGA
CTAGGACATTTAATGTCTCTGTTGTCTCCTGGGAACTTATTTCCACAGTTGGATGGGTACTTATTCCCTCACTAGCCTATTCGGCTAAATCATCATATGA
CACGAGTAGAATTGCTCCCTCGTTATCCTCTGGTGGTGGTTGTGCTGCCGCGGCCAGGTCTTCTACCAGAATCTGGCTTCATGGTGTGGCGATCAGCCAC
TTCATGGCCATGTGCAGTCGTACTAACGACCGAACCACACACGACGCCATCGCACTCGCTCGTAGTACACCCACATGTTAGTGGGCGCTCTATGGCGTTC
ATCAGATCGCCATCTGATGAACAAGTGACAGGCATATCGACAGTTCGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGA
TAACACCAAATTTGTCATCCAAGTCTAATATGATGAATTCATCGTTATATTGGACTCCCTTCAGTGCATAGGTAATACCCACTACACGTTTCATCACTGC
TACGGATGCGCCTGTCGCGAGGCGCACCTTCATCCTCGTTGGAGGGATCTCGCGCTCGATATATTTGAGCTCTCTGTTGTCTAGAGATTGGCGTCGTACA
AAGTTGTTCGACGCCCCACAATCGACTAGGGCTCGAAGCGACATGCTTTGTGTCACTTCGAGTGTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAG
CAACACACAATGACTGAGTGTTGGGAGCAACTTTTGTCAAAAGGCCTGCAAACTCACTTGACGTTGTTGGATCAGTAGGGTGCTCCGCACCTACTGACCC
TGACCGTTTTTTGGCTGTCCGTTACGATGTTGCGGTTTCGCAACGACGTCGGAGTCACGCCTTGGACCTCGCTTGGCCGCTTGGCAGTTACTATTTCCTA
TGGTACGTGGTACCGCGCTCGGGACACTGCATTCATATGCATAATGCCCTGTCTTTTGACATCTATTGCATTTTTGCAATTTCTTGTGGTTGTTAACACG
AGAGCTCTCGCTCCTCGCGTTAGAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGATGGACGATAGAAATTCGAATTCGCGTGAGCCTGT
TTCACGCTGAAGTCCTTCTGTTCCGCAACCCTTATTGCCTCTTCTAGGGTATTGAACTCCAATCAGAACAGGTAGGTTTTAACAGGACCATCAGTCAGAC
CCTGCATGAAAAACGTAATCAACATTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGAGGTATGTACTGAATATACGAGTGTACGTCACG
TTTACCTTGTTTGATTCTCAGAAGTTCAGAGAGAGCCCTGAACTCAGCTCACAGCGGCTCAAATGTTTGCCTAAGCAGGGACTTGAACATCCAACGACCC
AAAGACATGTAATTTATGGCCCAAGGCCCACGTCTTTGCACGCTCTGCCAAGTTCGATTGAGCAAATGTGATCTGCATTTACTCATCGACGATGTGGAGA
GCCTTAATGGCATCGTTTAGTTCCCCGAACCATCTCAACAGAGAGTCTTCATCGGCTCCCTTGTA