Description :
From Genome Similarity Track
Location :
Scaffold_419:499566- 501329
Transcript NameFunction/comments
Aphin_H310_01008SgcA
Aphin_H310_01009Hypothetical protein

Sequence
1763 bases(100 bases per row)
CATCCATGACGTGGATTTGGAGATTTCACTCCAGACCCGGGCCAAGGTCATGCACCACTTTGACCACCTCAACTCGATGAGCCAACTCGCCATGCGCATC
ACGAGCGTCGCGATCGACTACATCCACTTTGACGCGCTCAACTACATGCTTCGCGCCGTGTTTGCCCTCGAGTACAACAATAGCTTCACCAACCACGACG
ACATCAACCACGACTTGCCCGTGTCGTTTTCGGACCAGAACGCATCGACGTTTGTGCAAGCGCTGCTCGGGATGTCCGTTGCCGAGACCCATGGCATCCT
CTCGATCGACCACCACAACGAAATCATCCGATTCTTGTCGGAGGACATGCGCCTTGTGGTGTACAACGTGATGCTGCCATCCCAGCGGGAAGCCATCCAT
CGCGTGTTTGCGCTCTGGTTTGAGAACGAAGTGCCCGTCCATCGCATCCCGCGGTTCCAGCATTGTTACCACCTTGCGTACCACCTCTCCCGCACGCACA
TGTACAACCAAGCGATGCACTACTTCGCCAAAGGCGCGGAGGAAGCGCTGCTCCGCGGGGTGTCCGAGTTTGCCCTCATGTGCTTGACATCGGCTGGGTC
CGTTCTCTTACTCATGGACACGAGCCACGGCCGCCTCGCGACCCCGCGGGGGCTTCGACGGTCATCCAGTTCGCGCTTGATGCACGACACCGACCCCGAT
GAAGTTGCGATCGAAGTGACCCTCCACCAGTGCAAGATCGAATTCCTCACAGGCCTCGTGATGGTTCAAAAGTCCGACTGGGCGACCGCCGTGGACCACT
TCAATGCGGCAATCGCCATCCACGCCGAGTTGCGCGCTCAGCGTAAACAAAAATTGTGGCATCGCCCGGTCCGCCGCATCCGACGGTGGTGGGAGGAAGC
GTCGCAGTTGTGGCGCGCGATGTATGGCGGAATCACCAAAGTCGCGCCATTGAGAGTGACGAAGAAGAACCACGGGATGCCGACTGAACCGTCGCTGGAA
GCGCTGTGGGGCGAAGTCGGGTCGTATATGGTCGTGGCAACGCGCCTCAAAACCAAGATTCTTCGCGTCGAGCGGGAACGGGAGAGGACCAGCACAGCGA
TTCGACTCCAAGGACTCCGGTGCATCTCGAGCATCAAAGATGACTCGATTGCAAACTTGGAAAAAACGTTTGTCCTGGTCCCCAACGATCACTCGTCGGG
CGGCAAGCTGCCCCGACGGTCTCACAAGAAGGGAAGCTCCAATGGCGGCATCGGGACGAGTTCCAGCGCTTCCGGCGTCGGCATGCGGCAACCGACGTTG
AGGAATGGAAGCGACGGCGCTGTGTCCATACGCACGGGAAGTCTTGTCCATCAAGATCACGCTGACGCGGCGCCATCGAGGATAGAAAGCCAAAAGACGA
TTGCACCAGTTATTTAGCTTAGCCCGTCCAACAAACCCCATCGTCAGACTTCCTTGTGTGCATTCCGCTTGGGCGTTAGCGACATCGCGCGCTGCATCAG
GGTCGGTGTGTGGTGGCTTCGCGTCGACAGCAGCAGCGAAGGACTGCGGACCGACCCCGGCGTCAACGCCTCATTCTCAAACGCGACGAGTTCGCGCTGC
TCCTCTTGCTCTGGCTGCATCAGGTCCGACGCTTCGGCGGCGGCCTGGGCCTGGTCGGCTCTCGCTTGCCAATTCACACGGGCTAGCCCCCACGCCAACG
CGACGACTTTGAACAGCTCGCCCATCGTGTCGGCAACCCAGAATCCATTGATGCCCCACGACA