Description :
From Genome Similarity Track
Location :
scaffold_27:49956- 70258
Transcript NameFunction/comments
g1356.t1hypothetical protein
g1357.t1 hypothetical protein PHYSODRAFT_344165
g1358.t1 conserved hypothetical protein
g1359.t1 caltractin
g1360.t1 hypothetical protein PHYSODRAFT_349450
g1361.t1 conserved hypothetical protein

Sequence
20302 bases(100 bases per row)
TTCACCAGAGGAAGACCGCGTACTCTATGATGTGGAAGACCAACGGCTGCGCTAGATATTGCCATCGCACATGTTGTTCTTCCACTCTAAATGGTTTTGT
TAAAGCTGCAACCATCCACCACCACAGTTCGTTTCCCCAGCTCCCAGCTGACGACGATGTCAATCTCCGAGGCATTGACATTCCCAACTGCCGCAATGCC
AACACGTTCGCGTACACCACGAGGCGGCATTTCTCGCGCTCTGTTGGTGGGAAATGCCGATGCAAAGCTGGTTTCCACACCACAGCCCAATCTTGCGACA
GCATAAATCTCACCTCAGCACGAATCCAAGAGGCCTCATCCAGCTTCTGCCAGAGTTCGTTAGCTGCCAAACACAGCAAGTTAGAACTAAACCTGCACCC
ACGTAAAGTTCGTCAGCAATTGCACTCTCTCTCTCTCTCTAACATATCGTTGCACGAGAAGCCCCCGCGTTCAGAAGCAAAGCCACCAGGGAGTTGTTCG
TGCGTGTCAGTGCCAGTGTCAACGCCGACGAACCCATTCTACAACATCAGCAGCAGAACAATCAATCTAATTGCCAACATAAGCGTCTCTGAGCAACAAC
CAACTCGTAAATTTGGTAACGTACAACGTGGTTGCGTTCAAATCGACGCCGTCCTCGTTCAAAAGCCTTCGCACGATGGCCATCCGACTGTGCGCCACAG
CGTAGAGCAACGCCGTCCATCTCTCCCCCATCATCACATTTACATCGCCTCTCGCTGAGAGCCAAGCATTGACGACATCAAGGTCTCCATCCGCGCGCTG
CTGGCAGGTCATCTTCATACCGGTAACACTGGAAATGCAAGGGTGTCACTGAAGTGGGGTAACCTGTAGGGTAACTTCAACAACATGACTTGCGTAAATC
GCCATCTATTGTCTTCGTCTACTTTTTTAACGTGCTCCCTGCGCTCAGCCCGTGATGGGAGGACTTCTAACTCCTTCTTCCTCTTCGCGTAGCTCGTCGT
CTTCAGGTGAGCCGATCGTGAACTTTGGCGAGGGGCCCTTCCTACCTGCTCGGGATCGAGGGGATAACGGATTTCCAGGCGGAGACGTTGGGGACAGACT
TCCAGTCTCGTTAATCTCCACAATCGTCTGCATATGCGCACGTGAGGTCTCAGTTGCGTCTGGAATGCGAGACCACGTACGAGTTCGCCACTTGGTCCAA
ACCATGACGGCAAGTGCGACGCCCACCAGCGAGATGAGGATCACTTCCGCGATAAAAGCACCGAATTTTGGGCTTGACCGCTTTTCCGTTGCGTCTGCGG
ATGAGCCGGTGGTCACATCAGCACTGCCTGTCGCCAGTGCCGTTGCTGTTGTGTTCGATTCAGTAGTTGAATGGTTGCTGGAGCTGGTGGAGGAAGCGTT
AACACCCAGTGTCATTGTTGTAGGTGTTGATTGTCCATCAGTGGTTGAAGCCATTGGGGCCTCAGTCTCGGAGATTGGCCTGTCGGTAGTATCTGAAGCG
ATTGGCAATGGAGTACTCGAGTTGGTATAACTTTTGCCTGCACAAGAGATTCTGTCAGTCAAATTCCGTATTAATGCCATCTTCCAACAGAGAACGCACC
ACAATCCGACTCGGCGAAGCCCACGCGCTGGGTTTCCATATCAAAGATCACGTCGAAGCCGATCATGGTGCTCGCTCCCAAAACTGTACGCCATTGCAAC
AGTTAGATGGTTCAGAAGTAAAAAAAATGACGAGCTAACTAAGCTTACCTCCGCCACTGCGCTCGGAGAAGTGAAAGTTGCCGTAGTAAGTCCCATCATT
GTCGGAGGGAGTAAGATATCGTGAACCAGGAATATCCAGTTGAACGTCATCGGTGCCATCCCCTTTCATCCCCGAAAGTATAATAGAAATCGTCGGAAGA
GCTGCTAGCTCGTCGTCAGTAAGTTTCATGCGCTTCTCGCTATACTCTTGTCCTGCAGCATCCCGGAACGCTTTCATAAAGTTGCGACCTCCTTTGGCGT
CGAAAAAAGTATCGGTTGTTCCGCTATCAACAATCACTCCTCTGCCGGAGTTAATGGTCCCAGCGTCAATACCGAGTGACACGCCGTTCATCCGAATGTC
CTTCACATGGACAGGATAATAGGCGGAGTTATCGTTCAGTAGCGGTGTGTAGCCCACATCACTCGTGTGATGACTGTAATCCACTCCACCGAAGACAACC
TCGCCTCCATCTTCTGCAAAGCACAAAGTGAAGAGGTTCTGCGTCACACGCCCAGCATTTAGCATGTAGGACATGACAGTCGAGCGATGCCTCCCGAGAC
CCATAATGCCATTCTCCTTCTGCGTAATGAAGAGACCAGTCTCTTTAGTCTGACAGCCAAGTGGAAAGCGAAAGCCAAACGTCTTCAACACGCCCTCCAT
TTCGTCACTCGGAGTAGAGAAGCCCCCCACCCACACCAACTCGTCAACCACAACAGCTTGCCACATACTGCCTTCCATGTAACTCTGTTCATTCAATACA
CCACCATCAATGAGCACCAAACTCAAATACGAGGATGCATGTTGCGAAACTATACCTGCGAGATCACGCAGCGATCATTTTCACATGATCGGCATGAATC
GAAGTCATGACAACCTAGATACTTGGCTGTCGTGGACTTGGACACGTCAAAGAGCGGATCAGTGTGTGTACCACAGCCATTGCACGTGCTGCACGGCAAA
GCTGTCAAGTGGCTGCCAGTGTCTAGGATCACTGAGGCTCGTTGTGCTGGGATACCCAAGTAGATCTCAGCATAATGTGTGCTGCAAAGCAAGAAGTACC
AAATACCTCGTCAACTCCTATATCCGCATCTGTCCATTGCGCTGTGCACGCACCCGTAGCCCACACCCAATGGAGCTTCACTCAGAGCCAACGAAATGTT
CCTATCACCAGTAACTGCCTCCTCCTGCGCCCTCCGTCTACTTCGAGCTTGTTGGTGAGCCAGCCGGTGGGACAGATCCGATCTCGACTGCTGCTTGTGG
AGCTGGATTCTCATAAAACTTTCCTCGCCAGCGACTGCAACACACACTTGAGAACATGCTAAAGCTGCAAGAGCAACCGCAGATCGCCATCGAGCTCCAG
GCTCCGTGTGTGGGGCCGTCATAGCGGCGATGCTTTATCTCAGACTGGGGGCATTGCTGCAGAGGTTACCGCGGATCTATTTTTAGCCAATTGAAACGAT
AAGAAGATGCTGTCTTTATTTGTCGGACATGGCTACAATCAGAGTGACATGGTTACACTCTTTTACATGCAACTTGCGTCGGGTATCTTTATTTACTGGG
CAGTGGCGAAATACATGATCCGTTCTGTGCTACTCAAAGCCGCTCCAATGTGCGGTTGTCCACCTTGGTCTCCTGCAGAGATTTCCGGTCAAAGACTTCG
TCCTCCTCGTCACTGCTACTTTGATCGTCATCGTCGTCGTCCTGGTCAAGCCGCTGGTGCTTCGATGTAGGCGCCGATTGTTTTTTGTCGTTGCGAACGA
CACCGAACTCCTCCTCGTCATCGTCGTCCTCATCCTCCTCATCGCCCTTCACACGGCTCCAGAGCTGATCCTTGCCGGTCTTTTGTTTCCGTCGACTTAC
TGAAATCAGCATCATCACCAGAAAACCAACGACCAAGACAGCACCCACGATAGTCAGCACCATTGGGTGAGCGCCTGTGGACTCCTTCTCCTTCGGATTC
TGATCTCCAGTAGCTGCTGAGGAAGACTGGGTAGTTGTCGTGGTTTCCTCAGACAACGGCTGAATGATCTGATCAGTTGTTGAAGCAGCATTCAAAGCTG
AAGCGTTCGCTGTCACCTCTGTCGCAGCAGGAGTTGACGTTGCCGTCGCAACAGGCTCAGAAGTTACCGTGGCGGTGGGCTCGGGAGTCGTTTCCACTTC
TGACGCAGCCGTTGCAACTGGCTCTGAATACGTGGGCTGCGGCGTTTTCCAAATGACTGCGGTCGGTTCGGTCAGTTCGGATGTCGCGGCAGCGGTCGGT
GCTACCGTGTCGACTACTGCTGGTGTAGCGCTCGAAGCGGCAGCGGTTGTAGCCGTAGGAACGACATTTTTCTCCTTTCCTTCAGAGCCACTTGTAGTAC
TAGTAGCACCTTTGTGAATGGATGGAGGCGCTGTCGTGTTGGCACCTCCTTGGAAAGCGCAGTCAGCATCCACGAAGCCCACGCGTTGATTGCCAAGATC
AAAGATCACGTCACGGTTCATCATAAGGTTGGCTCCAATAACGCCGCCAGAGTTCTCAGACAGATAAATGCCACCACAGTAAGCACCATTTGACTCGAGC
AAATACTGCTCAGGTGGCACATCCAGAATCACTTCAGCGTTTTCGTCTCCGTAAGCCTCCATCACGAGCTGGATAGTGGGTAGTGACGCCAGGTCCTCGT
TCGTATAGCCCTTGCATGTTGAGCCAACCTGATAGTCGCGTCCCGTAATCTCCTTAAACACCTGCAAAAATTCCGTCTTCAAGGCACGTGGGAGATACGA
GTCGGTAGTTCCACTGTCCACAATGTAGTGGCCGCGGCTGTATGCCTCCTCCTTAGCGTTGATGGACTTGCCACCAATGCGGATGTCTTTCATGTGCACA
TTGTAAAAATGGCTGGAGCAAATAGCACAGTAATATCGTTAGTATAAGTAGAAAATTCAATCGCATTGCTGTACAAACAGTCCATCCTTACCCGGCAGAG
CGGTCAGAAATCACTTTCGCGTACGAGATCTCACCCCGATGCGCAGCCTTGTGCGGCTGCCCAACAGACATAGTGCCGCCATTTTCAGTAAAGCAGAGCG
AGAACAGGTTGCTGGGGATCTTGTTCTCCCGGTGCAGCTTCGCCACAATGTGGTTTTCCGTGTTGGACAGTCCCATGATGCCATCCGCCACCTGCGTGAC
AAACAATCCGGTCTCCGAGCTCTGGCAGCCGAACTGGAAGTGCGTTCCGTAGCGGTCGCGCATGGCCTCGTCCTGGAAGCTGGACTCTCCTCCCAAATAC
ACGACATCTTCAACGACGGAGGCCTTCCAGCTGCTTCCTTCCATGTACGACTGGGAAATGCCACATGTGTCCGACTGCAGCTTGCACTCCCTGCACTGGA
AGAACGACCGCTGCGCACAAGTCACATGGATTAACGTAGACGAGTTGTCGGCCTGGAACGGCTGATCTGTGTGTGAGCCGCAGCCGTCGCATCCCGAACA
CGGGAACGCCATCAATCCGCTGCCTGTATCCGCGATCACAGAGGCTCGCTGAGGCGGAGTACCAGCATACACCCACGTGTAGTGCGTTCTGTATCGGTCA
CAACGTCATCAGAAACTTCCAAACACGCCACTGTCACTGTTTAGCAGATCGTACCCGAGTCCTAAATGCATCGGCACGAGCTCCGGAGCGTCCTCTTCGA
TGTTCAGGCGTCTTGCGTATCTCTCCGGGTGGATATCATGCTTGGGCAGTCGATGCAGCTGCATGGTCATGCCAGCCTCTTGCTCAGCCTTTGCCAATGA
CGAGAACGTCGAAATGGCCGCCAGAATCACCGGAAAACCAGCGATCACTCGCACCATTCTTACTGAAGTGTTAATCGCCTTCCTGGTAAAAATACTGCGC
TGTCGGGAGTGCTGGAACGCTTGAGAATGCTAGTGCACTAGATTAAACGGCTGAGCGTTCGTGTGAAGCGAGGAAGAGAGCTCCCGATCGATGGGAGAGC
ACCTTGGCACGTGGCAGTTTCCCACAAGTGACAGCTTTTTAGTCCCCTTGACCTGAAACGACGTCCTCGAACCCCCAAAAATTGAGCTAAGGACCTAAAT
TTGGTCAAATGGTCCGAAAAAAGTATATTATCTTCTGAGCCTTTACATCCAAGTTGCTGTCTCTCAGTCCGAGCCCATTTTGCGCCGTAGCAGCGTTGAC
CACGCGCTAGTGCCGCGATGTTGCCGAGGTGAGCGTAACCCGTCGTCTGAGCTTTTCTTGGGGCTTGGTTGCACTGAAAACTCTCGCAATGTGGCGGTGG
AATCCGCCATTCGATTTGACAGTCCAACCAGAGGAACCTCAAAGCGAGAACGGGGTGATACGCCAGCATCCGCTCTCTTTTTGCTGCTGTTCTGGACGAA
GAGATCGTGGCGGATTTCGTCCAGTAGCTGCTGGCATTGTGGAGAAACCACGTGTCTTGAAGCCATGAAGGCGTCGTTGGAGTCCGCGGGAAGAGCTTCT
TTCATGTTGAGCAGCCGTTTGCGAAGGTCGTTGTCTCCACCACGGCGATGTTGGGTTAGGAGGGCGGCAGCCTTTAGTTCTACCTGTGAGCCATCAACGA
GGCTTCCCTGGTTTCCATTGTCGCCTTCACTGATTGCTGGATCAGCATCACCTGCCGTTACTGAAATCCTGTGGTGCGAAGTTGCCAGTTGATCTGCCGA
CATGACGAGGAGCTCGCCTGTGAGCTGTAAATCGGCTTTCACTTGGTCCGCTCTGTTGTTGGAGCCATGGGCAAAAGAAGGGAAGTCGCGCTGCTCAGCT
CGGAGGAGCTTGTGTTGACTCCAAGCAGCCAGAAACTCCACTGCTGGCAACAGAGTTCGGTGATCCTCCAGACTCTCATCCACCCAGTCGATCTGCTGCA
ATTGCCGCTCGAACTCGAGCGTTTCACCGGACAGCACTCGCATCTTCACCGCTACGGCATCGTCCAAATTTTGCAGAGCTTGAGCACACTGCTCTTTGAT
GGCAGCTGCAACCTGCGCCTTGTTTTCTTGGACGCTACGTTGAATCCGAGTCAAAACCTGGAGCTTGTTTTCGATCACGGTCTTGCGCGACGTGATCAGT
GGATCGGGGCGCAGTGACTCGCGTATAGAACTCTCGTAGGCATCCGCAACGGTCAATAGTCGATGAGACCCTTTCTCTCCGATCGAGTGATCTCCAACCA
TTTTACAGGTCACACACACGGGAACTTGGCACACGGGGCAGTAGAACTCCACCTTCTTGCCATGATGCGTGCGGCACGTTGGTCCCTGTGTCTCATCGGT
AGATAAACCATCTTCCAGCTGCTTTGCAATGATCTCGCTGACCTGCGCTTCCGTGAGTTCCGTGCTGCTTGGAGGTTGGGCTGTGTTCAAAGGACTTTCC
AAACCGATTTCCGCGATGGCAGCGGCTAGTGATGGCGCCGAGCTACGACGTCTGCCGCGTCTAGCGCCTCCACTTGCCACTGTCTTGGACTTGCTGCGTA
ATGGCGTACGCTTGTGACGTCGCACCAACTTGTTAGCCGAGTGGACTTCTTGGTCACATTGAGCACAGATCTGAGCTTCACAGTTGCGGCACTGGACAGC
CGCAGGATGCTGCTCACAAAGAGCGCAAGTACCAACAGGACCATGCGCGTCGGCTGCTGAGAAGGTGAACCGAACGAGGTACTGGGGTAAGATTTGGAGC
GTGTTGTTTAGGATGTACTCGTGATAGTAACCGCGATCGAGTAGTGCATCTTGCACGTTGTGGTCTTGATCAGAGCCAGCTTCTTCTCCACGATGCAGGT
AGTAACTGTGATACCCAGGTGGGAGCCGTCCTATAGCCTCGTCCTCACCCCGAATAACAAGCGATCGCCCCACTGCAAACTTACAGAGGACAAATTGCCG
CGTACTGGATGGTTTCTTCGCTTCTGCGGACTGGTCTAAAGGCGCACTGAGTTGAAGGTTTCCAGTGGTGAATTTCATTCCCGTTTGGTTCGCGTCGAGA
GAGGTAAAGCCGTAGCTGTGTACGTCGCCCATGTCGGCACCAATATCGTTCATCGCAACCCAGGACTCGAGCTCCAGCAGCCCTGTTGAGTGCTGTTCGT
ATTGGGCCACCAGCGACGGGTTCCGCATATCCCAAATCACAACACCTTCGTGCACACGATATCCAGGCAGCGAGCACTGCAACAGGTACTTTACTCGTGC
AAACTCCTTCGATGATTGACTCATGGGTGCCACACTCGCCACCGCACCTGCAGCAGGGATGGTAGTATGTATAGCGTCGTCTTCTTCGTCATCCACAAAG
ATTTCAGGACAAGAAGCGACGTCAGCCCATTCAGAGGCTGGAAGTGGCGTCTCACCCTGCGAGCTCTCGTCGCCCTTTGGCGGACGTTCTGGAGATGCCG
CTCGGACATCTCCGGGCCCATTGGGGGCATGCGACGACAGGAACAGCCGCAGCCGAGCCAACGACGCGCTTGCTTTCGCTTCCTCGGCCTCGTTTACTAC
CATTTTGGGAGCTTATTCCAGTGTCCGAAAGTGCCAATGCGCGTAAGAAACCAGTCGTTTCAAGCAGTGTCCTTTGGCTAATATCCGCTAGGAATACAAC
TGGATCGCGTGTAAATCACTGCACGGTTGGGGTGAACTGCAGCTCGCCATTCACATCCAACGCACATTGGCAGCTTTGCTTCAACATGTAACTTCAACGT
TGATTTTGTAGTTGATAGCACCAATCTGCGATCCAACCTGCGAATACTTGCAACTTCCATGTTGTTACTAAAGGTTTAAAACTACTTTGAGAGCTGTGTT
TTCAATTGGTACTGCCACCAACAGAGCGGCATCGTGTCAAGAATCTCGAGCTCTCTATCTAGGGCCGGCAACTCGCACTACCAGTACACGAATCGGACTT
TACTCGTGCAAGCAAGCGTCGGGTTGCTACATGTAGTTATCATGCTCGCACGTCGCAAGACACAGAAGGCACTGCAACACAGGGACGCGATCGATCAGGT
AGACCGATCACGTCTGAAAATCATTTACATGTAGCGCGCCAATTGGGAGTCCGCTGCGTTTGTTCCCGCCACCTCCAGACGTCCAACCAATTTGCCTGGC
CGTTTTCTAGCACATCCAAACGGGTCTCCACTGAGCCCATTTCCCTTACAAAAGTCAGTCTTTTTCTTAGCGGGTTTAGACCCGTAGCTCTTCGCAAGTC
AAAAAGGCACCACTGCAGCGCTAGCCATTCGGCCATTTGTTGCCAGCAGTGGAAGTCGTTCGTCTGCCCCTTCACTCTCTCACCATGAAGTACCTGGCAG
TGACCGGCGGCACCGTGAGCGGCCTGGGCAAGGGCATCACCATCAGCAGCATCGGCGTCGTCCTCAAGTCGTTGGGCCTGCGCGTCACATCCATCAAGAT
CGACCCGTACCTCAACTGCGACGCCGGCACAATGTCTCCGTTCGAGCACGGCGAGGTGTTCGTACTAAACGACGGCGGTGAAGGCGACCTGGACCTGGGC
AATTACGAGCGTTTCCTGGGTATTACACTCACGCGCGACCACAACATCACCACGGGCAAGGTGTACACGCATGTGCTGGAGAAGGAGCGTCGCGGAGACT
ACCTGGGCAAGACTGTGCAGGTGGTGCCTCACGTTACCGACGCCATCCAGGACTGGATCGAGCGCGTCGCCCAGATTGGCGTGGACGGCAAGCACGCTGG
CGAGGCTGGCGCTGTGGACGACGAGGAAGCCGACGTCTGCCTCATTGAGGTCGGTGGAACTGTTGGCGACATTGAGAGCATGGTGTTCCTCGAGGCTCTG
CGTCAGTTCCAGTTCCGTGTCGGTCCCGAGAACTTTTGCCTTGTTCACGTGTCGCTTGTGCCCGTTCTTGGCTCTGTGGGTGAGCAGAAGACCAAGCCCA
CGCAGCACGCCATCAAGGAGCTGCGTAGCGCCGGTCTGTCACCTGACGTTATCATCTGCCGTAGCAGCACCGAGCTGGAGGCCGCCACGAAGGCTAAAAT
CGGCATGTTCTGCCAGGTTCCGGCGAATCACGTGCTCTCCGTGCACGATGTGAGCAACATCTACCACGTGCCGTTGCTGCTGTCCAAGCAGGGTGCTGCT
AGCATCCTGATGTCTAAGCTGCAGCTGATGGACCGCTTCAGTGAGCCGGACCTTGAGGCCTGGTCCGCTATGGCTCACCGCGTGGACTCCTTCGAGCAGA
TCTGCAAGATTGCGCTCGTTGGCAAGTACACGGGTCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTTAAGCACGCTACCATGAAGTGCAACCGTGA
TTTGGAGATTGAGTGGATTGAAGCTAGCGACCTGGAGGTGGAGATGCGTGAGAGCAACCCCAAGGCTTACGAGGAGGCCTGGACCAAGCTGCGCAGTGTG
GACGGTATCGTGGTTCCTGGTGGTTTCGGTGACCGTGGTGTGGACGGAAAGGTGCTTACCGCCAAGTACGCTCGTGAGAACCGTGTTCCGTACTTGGGCG
TTTGCCTGGGCATGCAGGTTGCAGTGATTGAGTACTGCCGCAATGTTATCGGATGGAAGGACACTAACAGCGAAGAGTTTGACGCGAACGCTGGACACAA
GGCGGTTGTTTTCATGCCTGAAATTAACCCGGAGGTTATGGGCGGCACCATGCGCTGCGGTGAGCGTCGCACTATTGTGCACGAGAAGGAGGACCCGGCG
AAGCGCTCGCTGGTGTCGTACCTGTACGGCAAGGACAAGCCGATCCTGGAGCGTCACCGTCACCGTTACGAGGTGAACCCGGAGCTTGTGCCGGCAATCC
GCGAGGGTGGCCTCAACTTTGTCGGTACGGACACCAAGGGCGAGCGCATGCAGGTGATCGAGCTCGACCGCGACGTGCACCCGTTCTACTTCGCCACGCA
GTACCACCCGGAGTTTAAGTCGCACCCGAACGATCCGTCGCCGCCGTTCCACGGCCTGATCCTGGCTGCTACCGGCCAGCTCGAGAAGTTCATGAAGGAC
GTGGAGACCAAGGAGCAGGAGCTGTAAGCGAGTGCACTGGGCTAGAGGCGATGGAAACTACTGCGACGCAAGAGGAGGTGGGCGACAGATGGTCCAGCGA
CGACGTCTCTCGGCTTGGAGCCGCAGGTTTGCGTGTGAATAGGCTAAAATATTGATTTGGACCCGTCCCTCCGCTGCTTTTGCCTTCGTTTTTCTTCCGT
CGAAGGAAAACGGGGCGAAGCTCTCGCGGTGGGATTTTATGTCCGCAGTAGAACTAGACACCAATACAATTTACTTTATTTATTCCAATCCTTCTCCTTT
TCTTTCTCCTTTTTTGTCTGACGTACTTGAAAACATGGCTACAGTTGCCTCAGATGTAGCCATGTATTTCGACGAATCAAAAAGCTTAGAGTGGCACACG
ACGTGGCACATTCCAAGATGACTGAAGAGCTGCAGGAGGCGGTGGACGGCTTCTTCTTAGCGGCGGAGTATGGCCGTTCCGACGTCATCAAGGCTCTGGC
AGACCACGGCCGCGGTCATCTCTCTCTGGCTGACGTGGTGGACCCTGTGACCGGTCGCTCCCCGCTGCACGTGGCCGTGGCGAGTGGTAAGAAGGACGCA
CTGCGAGTTCTTCTTGCTGCTGGCTTCCCCCCACAGCATCAGAGCAACAGACAGGAGGGTAAAGAAGATGGCAATCGATCTGCCTACGCGCTGGCTCAAG
ATTTGAAGGCGCAGGATCTGATTCTGGTGTTCCACCAGTTCTTAATCCAACAAGTCGCAGCTAACGACGTTATTAGTGTTAATGAATTACTGGAAGCTGG
TGTGGATGTAGCCGTGACTGATGCGGCTACGGGCGGATCTTTGCTGCATTGGGCAGCGTCTTGCCAAGCTGTGGATGTGATGAAATACTTGCTGGAGAGA
GAAGACGTACAGAAACAGAAGCTGGTAAATACTCTTAATGGAGAAGGCGCCACGCCGCTGCACTTGGCTTGCCATACGAACCAAGTGGAGTGCACGAAAC
TGCTGCTGATGCACCATGCTGATGCAAGTTTGAAAGGGGAGAAAGGGCTCAGTAAGGACAAAACAGCGCTTGAGCTGGCTACCAAGCAGGAGGTGGAGGA
GTTGTTTTCTCAAGAGCAGGAAAAGAGCGATGTGGTTGATAAAGCCGAGCTGAATCCGCTGGAAAATGAAAGTGATGCTGTAAAAACTACAGGAGAGAAT
AGAGAAGCGGCGTGTGGCTCGACTGCTAGTGGTGAACGACGCGGATCAGGAACCTGCCCGCATGAAATCCAGAATGGGAAATTACAATTGCAGCTCGAAG
AGAAGGATTTGCTTGTCAACCAGTTGAAAAAGACCATTGAAGCGCTCGTGCAAGAATCTCAGGAAATACAAATGCTTGGAGAAAACCGCGTGATGCTAGA
CTATGTCCGGAAACTGCGTGACGAGAAGGCGGTCGTCCAGAGGCAGCTCGAAGACGCTAACGACTACATGAAAGACCAACAGCAACAACTTGACAGTTTG
AAGGAGCAGATCCGGCAGTTAGCCACTGCGGGAAAGCAGGTACGCAACGGAAGTCTTACGCGTTGAAAACGTGGGTATGCTTACGACACTTATTTTTTTG
AAGCAGATTGAGACTGACCACGACATTCTCTCTCATACCAGTGATGGCACGGTGAGCAGCGTCGCAGGTGGCCCTCCGGACAGCACCCACAGTAACATGA
GTATACTGGATTTGAATCAGCTCGAGAAGCAAATTGATGAAGAGGACGATGAGCCCCAGAAGCCTCAAGCCCAGCCGTTAAAACTTGATGCATGGACGTC
CAAGGCGCAACGTGAGCAAGAAACCTTCAATCGATACGTTGAAAAGCATGGTCCTGACATCTGGAGCACTGTGTGGAACGGTATCTGGACAGGAAATGAA
GAGAGCGAGGCGGCGCAGGATGAGGATGGCGAGGTCATCATGACGGTGTAGAATTAACGACCAATTGAAGAGCAAATGGATTGGATTTTTCGAAGTCGAA
GGACCTAGCGGATCGGCGAGGCTGCACTTGGAGTGTCTTGCTGTTGCTGCTGCTTGTACACGCTAGTGAGGAGTTTCTCACGCTTTTTAGGCTGTTTGTA
CAGCGCACAGTTATTAGCACACGTCGAATTTGGCCCAACTTTACCACAAGAGCAGAGAGCTGGACCACCAATTTGTGCTTGAAGAGCTTTTAAAAATCGC
TCATGCTCAGTCGTCGCAGTTTGGCGTGTTGGACGCTTCTTGGCCGACTTTTTCCTCCAAGGTGTCGACGATGTGGTAGCTTGGCGATGAACTCGCACGT
CACATCCCGCCGTCATATCGATACTATTCAATGGTGTTAGTTGTACAAACGTAGGTAAGCTGTTTGTAGTTCACTTACATTTTGACGGCAGCCCAGCGTT
CCCCATTGTCGTTGTGTTCTGCATTACCCGCACGACGAGACCTACTACCACTTACAGCTGCTGCGACAGAGCTGTTTGATAGCGGAGACTTGACTTTGTT
TGAGGTGGGCGGATGGCGCCAAACGTTGTTTTGGACTTTGGCTCGATTCATCTCCATGTACTGCCGTCTCACTGTCGCGTACAGAGCAACTCGCTGAAGA
ACAAAGATAATAGTTATGCCAAAGCTGGCACTGGCACGTAAAGAATACCCTCTTACCTGCTCTGGAAGCAAAACGGGTGATGCAGCCGGTTCACTTTCGC
TGTTGCCCTTTTCGTAATCGGAAAAACTATGTGAACGCGAAATTTCAGTTGATCGAAGTAAATCATCGCGGATCTGAGCATCTACATGCAAAATCTAGTG
GATTGGGTAAGTAGAAGACTTCGCCTTGCTCAGAAAATACGCACACTATACCTTTTCAATATGTTTCCCCAATGGACAATCCTAAACAACGCCAGGAGGA
AATAAATCATAAAGTGTTCTAGTGCCATAAGACCTTGGTTTACAAACCTTCAGTACCGCTGTCTTGTCTTCTTTCAATTTTTGAAAGTATTCACCGGTCG
ACACTCGTTTAGCCACAGTGTTTCTCGTGTGCTGTGTCACCTCTGTGGTCGAAAAAACCTTTGCACACTTTTCATCCTACACGGCAATAATCAACAAACC
TTCGGCTTTGATAAAAAAAAAACTAATAAAATAAAACAACGCACCAAATGCTTTTGTGCGCGCTGAGCTTCAAGGCGATTTTGTCGTTCTCGTGCCGTCA
CGCGCATACAAATCTTGTCGTGGAACCTTTTTAGATCGTTTGACTGGGCGATAAGGCGAATTTCGGCTTCCTGACGCATGGACTCTGTTTCAGCCTGTGT
GCGTCATCCGATTAGCTTTTCGGGTTCCCAAACTCTAAATACTTCAGCACGAGCATACCTCGACACCCACGATACCATGATCTAGCCACTCGAAATCCTT
CTCGTTATCTATTTCATCTCTGTAGATTCCGCTACATATCTAAAAAAGTTAATCATAAAACAAAAAGCCAAGAACCGAGATTTATCATAACGTACTTGTT
GATAAACGCAACACCTTCGGGCACAAAGCTACTTGTAAGTATGCCAAGTAAATACTTAAGAAATGATGCAAAACGCACCATGCAGTCGTCTATTATCTCG
CTCGTCCTCAGCAAACTCACTCATACTTAATGGTCTTAGCTCTAACCGCTGTATGATCTTGAAAAAACGCCGACTCCAAACATGGATACACCCATGAAAA
GACGCGTGTGTAGTCGGCAAGAGGATACGTAGAGCAATTGAGCAGCATGCCATTGACACAGTACTATCATGTGCGCGATCCAATGGAGAATTTGCTCATT
AGCGTCACTCTGCGCAAGGTAAGGCGAAAGTTTCGCAAATTTGAGCACATGAATGCAGGCTGACTACATCGTTTTGAAGCATAGATCTCTGGATTTGGAA
GCGACAACTCGGTGACTGTGGGACGTACATGGAAGTATAGCTTCCAGTGGCAAGAAAAAAAGCTCAGCTTGAGGTACGTCTGAGGTTTTGGCTGTCAAGA
AGAACAGGGTGGCTCATAAAGAAATGCACTTTTATAAGCGAAAAGAAGCAAGAGCAGGAGCGTTTAGAAGCAAGAGGAATTCAATTATCCAACCGAAAGG
TGCGTGCGCAAGTTACTCACGCAGCTCGAGTGTTTTTTTATCACGTTAACTGTTCATATATTATAAGCGTGGAGATAGAAAATCACTCGACGGTACTGAC
GCGGATATTTTGTCTTCCTACGTCGATATTGACGATTTCGTTCCGATTGAGGTATGTTCGCTGGAGAATTGTACAAAACAGTATTTCAAATTTACATTTC
GGTTGAATGCAGCAAGTGAAGGACCTTCCAAGTACATCGAAGAATACTCCAACGCATCTCATCTCGCCAGATCTCACCCGGCGACCACGCAACAAGCAAA
ATGAATCCTCATGGACATCAAACCAGTATCGTGCCTGGCTTCGAGCTAACCGCGAAGATAAATTCCGTGCGATGCACATCGTTGCACTCGTGGAAGGTGT
GGAACGTGTGCTTTGCTCGATGCGATTTTACAAGGAAACCGGCCTATTCTGCGCTACACCCGGTTTCTCTGACCCAATTGTTGACCCTGAAACGGATCCA
GACTTGTTTCTCAAAGGACCTAAGCTTACAACGTATCATGTATCTACTCCTTCGGGTTCTCTGTACGAATACGTACTAGACAACGCTCATGACCTTCTCC
CATTTGCTTCCGCTGGAGACCAAAGACTTTCAAGAGATATCCGAATGCAGGAGGAAAAACGCGATATAGCAGAGGTGGCCCGGTGGCAGCTGAACAGGAA
CCCGAAATTACAACCAACGATTGCTGGAAGCAACGATATGCAGCGGAAAATGATGATTTCGATTGAAATTGTTGCAGTTTTTAACCCACAAACAACGGGT
CCTGTTTTTGTGGAATACGAACTCAAGCTACCCGGCCGTTCAGGACACTCTCAGTGGAAATTACAGCCTGGAAATTATATTCGAAAATGTGGTAAAACCC
CAATGTCATTACCTCAGCGATCAGCGTATCTGTCCACTGCTGCATTTGGATACCATCAGCACTTCAATCTAACACTCGAAGTAGCAGAAGCTGGCAAAGA
AAGTGACGTTCATGGTATGGTTTCTTCTCCTGTCTTCCATTTGAGCGTGTATTCTCGAGATTCCTGGCGACGGAAGAGATCAGAAGGCCATGGAGAGATA
ACATTAAGAGGATCTTCCGGGTTTTACGACCTCGACGTACCTATTCGCAAACCGATGGCCTCCATCCGCGATCAGATGGGGGAGCTCTTTCTGGGAATTG
ACGAAAGTGATGAAGACTACGTAGGGGATCAAGCGCGAGATTGCCAAGTTCACTCGGATGAATCACCTCTCTCCACAATGATCACCAGTCGACTTGGACA
GAAATCGGAATCGACAGGCACAACGGTACGAATTCGCTTCAATATCGTCGATCTACAGCCTTCAAAGCGCAGTACAGGAGCTGATACCACTCGGCTGACT
CAAACACCTACTGCTACACCTTTCGTCAATACGCGAGTTGTAAAGCGAAGCGTACAGGAAATATTGCAATCGGTTAAACTGGAGAAACGATTAGCTAGTA
TAACAGACCCCCGCATTCAAGCAACACTACGCTCGATGCCTCCGACCAAAGCAGGAACAGAATCAATTAAACATGATCTAGTTTAGATTTGTGTAAATGT
GTCTTGAAGCCACATACGCTTTCAGTCATCGTCGCTGTCCAGGTCGTCCAGCGGGTTACCACTGCGCTTCTTCATAACACGGAAGAACTCCTCTTCGTTA
ATGAGACCGTCGCCGTCGCGGTCAGCTTCATCGATCATTTCCTGCATCTCTTCGTCGGTCAGCGTTTCGCCCAGCTCCGTGCAGACGCGTTTCAAGTTCC
GGAAGGAGATTTTGCCCGTGTTGTCGTCGTCAAAGAGCTGAAAGATCTTCATGATCTCCTCGCGCGAGTCCCGGGAGTTCATTTTGCCCGTCATCATCTC
GATGAACTCGTCCAAATTGATCGTACCGGACTCGTCCTTGTCGATATCTGCGATCATCTGGCGGATCTCCGCCTTCTTCACCTGGAAGCCGAGCGCCCGC
ATCGCAGCCTTCAGCTCACGCACGTCGATACTTCCACTTCCGTCAGTGTCGAAGAGGTGAAAAGCCTCTTTGATCTCCTCCAGGTCCTCTTCATCCAGCA
CCTTCTTCACCGGCTTGGGCTTGCGTCGCAGGGCTGCACGGGACCGCGCAAAAGCCGAAGCGGACATAGCACTCGACTATGAAACGCAACACGTTAACAA
GCGCTTACACAACCAGATCTACACACAAGACGTACCATATTCAACGTTTTATCCTCGAAGCAGAAGGCGAAGTGTCCGTTGCAGGATAAACGTCCTTTCA
TGGCTCACTTCAACTATTTAGGATTAAGATCATCAGTCTAAATCTCAATTTTTAAACTTCTAAATTCTGGCGATCGCGTTCTATTTTAAAGATTTTGTGA
CGCCAGCACACTTCATCCTTGTATCATAGTCGCACTCTTCAATTGACCAGCAAGAGCTCACTTCCACCGACTCCCACAGTCGCACCACCATGTTAGCTGC
CGCCGCGAAGCGCATGCAACAGAGAACAGTGCACACGCTCAAGGCCTACGACAAGAGCGAGCACCGCGTGCTGGTTATCGGCGGCAACGGCTTCGTGGGC
AGCAACATCCTGCAGCGCGCGGTGCAGAAAGGCATCGAAGTGCGCAGCCTCAACCCGTCGGGCAAGCCGCAGTGGCAGGACGTGCCCTGGATCGATCAGG
TGGACTGGCACGAGGGCGACGTGTTCGACGACAAGCAGCTGGCTAAGGCTGTTGAGGGCGTCACGGGTGTCAGTACGTTCTGAAGAGCTACGGAATCATG
AATGTGCGCTGATTTTAGTGTTTATGACTGCAGTCTCAACGGTGGGAGCTTTTGGCAATAATGAATTGATGGAGAAACTCTGCGGAGACGCGACTATTGC
TGCTGCTAGAGCTGCGCAGAAGGCGGGTGCAGAGCGCTTCGTGTTCGTCTCGAACTCGCGCGTCGGCTCGTACTTCCCGTCCTGGTTGCCCATGCACGGT
TACTACCATGGGAAGGAGAGAGCTGAAGCTGCTGTGCAGGCGAGGTGAGAGTTCTAGGATGAAGAAGGTACTGGGGATTGTTCTAAAGCTGATTGACAAT
ACCACAATACTATTGTGTTTTAGGTTCCCTGACACTGGTGTGTCATTGCGCCCGGGCTTCATCTATGGCTGGCGCCGCACCAAGAAGGGTCAAGGCATCC
CGCTGCAACTTGTCGGGGCTCCGATCTCGATGTTAGCGCGTGATCTGGGAGCGGTTTCGACTGCGCTGGGCTACTTGCCTTTTGCTGGCGAGGAAATGCG
AGCAGCGATTCCCGTCGGTGCAGTCGCCAAGGCTGCGGTCCTCAGTGCGATTGGCCCGGTGCATGGACATTCGCTGGACACGACCAGTATGCTGGAACTT
GCTGCTTCATTCCATATCCACGAGGACTGAGCTTGAAGTGGCCTTCTCTTTAAGTATTTGAAAGAGAACTTAAATCAAAAGTAACATCTACAAGGACAGC
CAAGAAGTGATAAAACTAAAACATAATTATGATTGAAGAAGTCACAAGATTGAATTACTGCAGCTGAATGAGGGTTTTTATAGTCTATCGTCTCGCCATT
GCTTGGGCTGTGTACTTCATGCCTATAACGCCAATTTTTTTCTTGCGTTCTTCAGCGTCAAGTCGCCGCTTCTCCATCTCCTCCGTTCGGTCTTTCCAAT
ATTGCTGTCAATCAAGACAAAAGTTAGTCAGGGATACTTTCACAACTTCCAGTTATGCACAGAACTACCTCCTTTTGCTTCTCTTGCTGCTTCTCCAACT
TCTCCTTTAAACTTTTAGTGTCTGCTTCACTTTGCTCGGCTTGATCAGTAAGACAAAGCTCTTCTAATGTCTGTACCCAGAGGTCTCGGACACTTGTTGT
TCCTGCTGTCAGCTCAAGTAGCTTTTGTCCACTCTGTCCAAAAAGCACCAAGTCCAGACGACCTGGACAAAACCAACATTTGTTAGGCATTTAATCCATA
ATAACCAGAGCAGTGGAAGTGCCGTACCCATCGGACAAACTTTGCCGATCCGGTGAATCGGAAGTTCCTCAGCGCTACTTGGACCGGGTGTCTGTCGCCA
CATCAGCCTGCCACAACTACTTAGTCTAATACTTGCGCAGCCCCTAACAAAAAATATGAATTTCACCTCGTAGCTGCAGGGTTCAACTGTAAGTAAACGT
TCTCTGTCCTACTGAGCACACCCAGGAATGCGCTCTTCTTCTTGAAGTCGTTGCCTTCTTTGAGCAACTCCTGCCGCGCCAACATCTCCGAATTCCCACC
GCCGCAGCACACATTCCCCATGTTTCGACTTCAGTGCCGTACTTTCCTTTCAAAAATACAGTCGACTACCAGAATAGGATGTTGAAAACCATGCAAAAGT
ACTAAAACGTACGATCGACGTGTATTTCTCAAGACTTTGTTGGAGAAATCAGAAATGAAAACAACTAACGGGCAGCTTTGTTCGCAGAACTTAGGGGAAA
GCTGGCGACGACAACCAAGTGACGACTTGTCCGCTTAGCGGCGCAGAGTCCTCTTGACAGCGCAGCCACCACCCGAAGTCGGGGTCGTGCTGGAGCCCCA
AGGAGAGCCCTTAGTAGCGTCTCCAGCTCCACTCGTGGATCCGCCGGTGGTAGCGCCCTTGGTAGCGTCTCCAGCTCCACTATCAGAGCTCGTGGTTGTG
TCCGAGGAGCCGCCCTTGGTAGCATCAGTAGCTCCACTGCTGGAGCTTTCAGTCGTGCTTGAGGTTCCTCCCTTGGTGGCATCAGCAGCTCCACTGGTAG
AACCCCCGGTCGTACTGGAGGTGCCGCCCTTAGTGGCATCGGCGGCTCCAGACGCACCAGCAGCTGAAGAAGTTCCGCTCGAACCTCCCTTCGAAGCGCA
CGTGGTGGCCTTAGTCGGTGAAGTCGTGAAAGCCGTTACCGTGAAGTCGGGCTTGCCGCCCTTCTTCCACGTGCAGCACGGGTCGCCAAAGGCGGCGCCA
TTGGTCATGCTCGAACCGGGAAACTTGGCCTCACACAGACTCTTCGCCCACGTGTGGCCAGCGGTGGCAAACGCTTGAGCAAAGTCCGTCGTCTTCGAAC
TGTCGTCACCTGGGTGACCAAGACCCTGCTGGAACAAGCTTCCGTTCGGGAGCTCGTTGAGGTACTTGGCGAGGCCGTAAGCCGAGTCCATTGTGGCGGC
GAACGCCAGAACAGCGGAGGCGATTGCGACTTGAATCTGCATTCTAGTGGTCTTGCGTTGGTTCTGGGGGTGGTTTTGGTGGTGCGAGGCAACTTGAAAA
GTGAGAAAGGTAGCCGTGTTCGGCGTCGAAAAGCAACACATCGGGTATTTTACGGATAAAATTGAATCGAGGATCGGGCGTTCTGGAGGTGCTATTTTCC
GTATCTGCCGATGGGCACCAGTAATGCAACAACGACAACTTACAGACAGCGAAATGGTGAGGCGGGCGGGTGCACATCGCGTTGATAATCTTGGTCATTT
CA