Description :
From Genome Similarity Track
Location :
Scaffold_238:4995- 6039
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_238-fgenesh-gene-0.6Lipoprotein, type 6

Sequence
1044 bases(100 bases per row)
TCGCCTCGTCCTTGAGCTCCTTCGCAAATGCGTTCTCCAGGTACACGATGAGCGCGTCCGAGAGGTCGATCTCCTCCTGGTACGGGTGGATCTTGGCCAT
CTCCTTCTCGTAGTCGGCGAGCTTGGCCTCGTACTCGGCCTTCTTGGCCTCGTCCTCCTTCTTGCGCTCGAGGTCCTTCTTGAAGCGCACGAGGCGAATG
TTCTGGTAGTACTTGTTGTTCTCTTCCCGGAACGCGTTGCGCAGCTCCTTGAGCGTCGTGAACTTGTCGTCGAGCTTCTTCTTGATCGCAGTGCGCTCGT
TCGCCAACACGGGGAACTGGTCCTGCTTGTTCTCCTCCTCGTTGAGCTTGTAGAGCTCGTCCAGCACGAGCTTCTGCGCCGAGAGCTTCTCCTGCACGGC
GTCGATCTCGAGGTTCTTGTTCGTGGACAGCGCGCGGATCTCCTTGATCGAGTCGCTGTGCTTATCCACGGCGCCCTTCTCGTCCGTGAACTTGCTCACC
TGCAGCTTCTGCTGCTGCAGCGCCTCGATCTCCTTGATGATGCGCTTCTCTTCCACGAGCGCCATCGAGCGCGTCTCCTGCTGGTGGCGCAGCGACTCGA
TCTCCTTCTCAAACTCCTCCACCGAGCTGAACTTGAGCGTCGATCGCAGGCTGCGCTGGGTCTTGATCGTCGTCTCCTTCAGGTCCTGCACGCCCTTGAG
CTTGGCGGTGATCTGGTTGCGCTGCTGGATCAGGTTGTCCTTCTGCGCGCGCAGGTCGCTGTACACGACCTTGGCGGCCTTGATCTGCTCGCCGTACTTG
CCGCGGCCGCCCTTGAGCGCCTCCATCTCGGCGCGGATCACATTCTACAGCGTTATGCAACCATACACAAGCAAACAGTCCGTCAGTGCATCTTCCAAGC
CAACTAGAGCAGCAGACCACAAATGCAACGCACCGTGCGCGCCTGGAGCTTCTTGATGTCCGCGTCGATCTTGGCGATCTCGGCGTCGTGCACGGCCTTG
TCCGGCTTTGGCAGGCGCTCGATTACGTCCGGGATGTCAGCCTC