Description :
From Genome Similarity Track
Location :
Scaffold_5:49947- 51276
Transcript NameFunction/comments
Phyra_73805Hypothetical protein

Sequence
1329 bases(100 bases per row)
CTTGAGCAGCGATTGTACAGCCCGATACGAGAACTGGTAGCAGAATCACGGAAAGTGCTGCACGAAGCGAGTGAGTGAAAACCTTCATGCTTCTTGATGT
GAGCACAGGAAGTGAGTTATGGTGGAGATGGCGAATTCAAGAATGGGGTCCTGGGCGACGGGTTCTTGTCGAGGGGTAGCCGTATCTGGATAGTCTCTCC
AGAATCTCCAGGTGATTACTGGAACCTATCACACAACTCTTTTAACATCCTTGTTATACGTCCCCATTCTGACTCATGGCTGTGTCCAGCAGATCGATCA
GTTGTGCTCAGTGGACACGATGGTAGACTCCGCAGGAATTGACGATGCACTCCTTGTTGATCAATTCGTGCACAAAAGCATAATCTGACAGGCGCAATGA
TTACACGAAGATAGCTCCAGCACACCTGCGAACTGCGAAGTTTCCAAGCGGACAGTCATTCTTGTATCGTCTTTTGATAGACGGCATGGAAAACTGAGTC
ACAGATACTTTCATAACTTGTGAATTACAAGTCACACGGCGCAACTCTTGGTCATCTTGACCGTTCATCTTGTGGCGATCAGCGAGTTGAAATGATGCTC
GGTCTGCCAATCTGTTTTGCACTACATGCTGGATCCCCCCCCCCCCCATTCCAATTTAAAGTCTCGCCATCGTCAAATCCACTCAGCAAAGATGTTTTCA
TAGGTATCTATCTATTCGTCGGCCACATCGTTTTTCGCACGAATGTACCTCGACATGTACTCCGTGGCTCGAAACTTCTCGGACCACAAAATCCGCCCCA
TCCAATTGTGTTCACGTAACGCGTGCTTCTCGCTCATAGCACGTTCCACTCGTTCCATCAGACTATCAGCATTACGCGATTGATTGTACCGCAACGAACA
TGTAGCCACACCAGCATCCCTAGCAGCAGTCCAGCGTGGCACGTCATGGTACAGACGTTGCATCTCGTCCGCAAAGGTCTCGGGGTTGTCAGCGATAGCA
CCACCCCATAGCGTGTCGTCTGAAGTCATACCCTCGGCTCCGATTGAAGTGGCCACGCATGGTGTTCCAACAAACCAACTGTCCGCGATTTTCCCCTTGA
TGCCAGCGCCGAACCGCAGCGGTGCGATGCTCAGGCGGTACTGACTCAGCGTCTCGTGCGCGTCGGGAGCGAAGCCTTTCATGAAGAACCCCTGTGTGGG
GTAGTCTAGCTTCACAAAGCGCTTGGTCTCTCCATAAGACCCGTAGATGTGGATCTCCGCATCATTTTCCATGCTACGGAACAAGGGCAGAATGGTGTTC
TTCATCCATTCAACCGCATCAACGTTAGG