Description :
From Genome Similarity Track
Location :
Scaffold_12:49945- 51041
Transcript NameFunction/comments
Sapdi_VS20SDRG_04724hypothetical protein

Sequence
1096 bases(100 bases per row)
GGACTCGCAGCGCTCGGCGGCAGCGCGTCGCAGAGCGGGGACCCGCCAAACGTCACGAACGAGCTGCGGGCCCACACAGGCGGGGCCGCCATTGCATTGT
ACTGGATGTCCAAGCCCGTGTACGCAGCCGCAGCACTTGCATCTGTCCGGAGTGCCGTTCGGACGCTCGTTTCAACCGCGGCGACTGCTGTCATGAGCGC
CTGAGGCACGGGAATGTAGTGCATGTCGATGGAGCCAAAGGGGCCGAGCGTCGAGCGCACCGCGGCAAACCCAGGACCTAGCGGTGACGGCAGCGAGCCG
TTGCGGAGAAGCACCGACTCGAACGACGCGTTGGCAAATGCATAGTCGGCGCTGTTGACGATGAGACTCGAGCCAAAGACACCGGGCGGGTGGTCCGTGG
CGTTGGCAGTGACCCAGCGCAGGTCGTTCCCAAAGCCCCAGTACATTTTGAAGGACGTTTGGCTCGCGAACCGGTACGAGCCATTGAGCGCCGTGAGCGT
AAACGGGTAGGAGAACCCGTAAGCGTTCTCGATCGTGTACGAGTTGAGGACGCCGACGGTCTTGTAGTTTTGCCACTGCATCTTGAACGCAGTGACGCCG
TGCGCAAGCCAGTACGCGGCTTCGTCGAGGACGGGCAGCGCGATGGGCGACATGGTCGTCTGGAGCCATTTCTGCCCCGACGCCGACGCCCGCAGCGCCC
GCGATATCCCAATTTCAAAAGCGTCACCATAGGCTGCCGTCCACGCGTCGCCATCGACGTTGCGCAGCACCGTCTCAAGAAAGACGGCGCCGTTGCTGAC
CATCGACGCGCAGCGCGTCGCCCGCGTGGACGTGTGCGCCAGCGACCACGTGCGATTCAGGTCCACAAAGCAGTAGGACGTTGCGATCCACGCTGCGTCA
CTGGCCGACGATCCGCGGAGACCTTTGATCGTCTGGACCAAGCTCGTCGCGTACTGAAGTTCGTAGCGCGCGCCGACGTTGCCCGGGATCGTCAGCGTGT
ACGTGGGCGCGCTGAAGAGCCCGGGAAGGCTCTGCAAGGTCAAGTCCAGAGGCGATGATACGTTGTTGAGAAGCAGCGCATGGTTGAGATATGTCG