Description :
From Genome Similarity Track
Location :
Scaffold_6:499421- 501395
Transcript NameFunction/comments
g947.t1hypothetical protein

Sequence
1974 bases(100 bases per row)
CTACTCGTGCTCTCGAGACACCACTGTAGCTATCACGCCCATCTCCGATAAACCTGCCTCGGAGACGGCAACGGTGCTGCGAGGCCACCAATTGAACGTG
TCGACGATTGCGGTGGATGACGCCGAGCAACTGCTGTGCTCTGGAGGACGAGACACCCAAACGATCTTCTGGGACCTGGCCACTAGCCACATTGCGGCTA
AGAACACCACACCGCAGAACGTCGTCACGTGCTCGACGTGGCTGCCGCGTGAAGCTTTAGTTGCCCAAGGCAGTGAGGATTTGAGCGTTAAACTCTGGGA
TCCGCGGACGCCGCTGCGCGTGCCCGCGCAAACGCTGCGGGGCTTCGTGTACTTCCCACTGAGCATTGCTGCCTATGGCAGTGATAGTGAAGAGGATAGC
ACGTATTTACTGACTTCTAGCAAGGGCTTCAACAGTGTCGGCTGCGAGGCACGAGTATGGGATCGACGCACAGAGAAGCAGGTCGTAGAATTCCAAGGAC
ACCAACAGGACGCAACAGCTTGCTGTTTCTTGCCCCGTACAGCAGACAGCCGCGAGCTTGAAGTGGAGTCTGCAGTGCTGCCGATGCTGCCGGTGACTGC
CTCCAAGGATGGAACAGTGAAGGTGTGGGATGCAGCATCGACTTCCCCACTAGCTGAAGCACATGCATACGGAGCCAAGCGCATGTTCACGAGTATGTGC
AAGGTGGACGATAGCACGCTGCTGGCTTCAACGTTTGGAGGTCAGGTCTTCGCGTATTCACTCGACCGTGAGCAACGAACGCTTGCTTTGATGCCTCGTC
AGCCAAACTCCAGCTAACATTACGCCAAACAGGAATAGCTTGCCTTTGTTTCTTGTCGAGTAGATCAGTATAAGTGAGAAATATTAGACAAGCGTTCATT
CATCGGGTGCTGAGTCTGCTCTGTGTTTACCGTGGCTGCAGGATCATGGCTGGCGATCTGCTTGCTGAGTGCGCGCTGCAGCTTCGAGCGTCCAGCTTCG
ACTTTGAGGTGTTGCTGGGCGCGTCGGTGACGAGCGTGTGGCAGGCACTAGGTCGACATGTGAGTCGACAGCTTACGCACCGAAAGGGGGTATCTCTACA
GCAGCTCGGGAAGTTTGGCTTCTACAAGGTGCAGAGCTCGATGCAGCCTCCAGTATTTCTGCTCGCAGATCGCTTTGCTTCGACATACGGCGTCGTGTGG
CGACACCGTCCACCGCCGGCACCGCTCACCGCTACCACGGAAGCTAATATGTCTGCTCTCGGTAACGATGTGGGGCTCGGATCCGACCAAACACGTCGTG
CTCTTGATGCCATTTTGACGTTTATCGGGAAGAAGTTGCAGGGCGGCAAGAGCGCTGGAAGATTGGTCCTTCCTGGGGTTGGAAGCTTTTCGCTTGACGG
AAGAGCTCTTTCGTTCACCTTTGACGCAAGCTTGCTTCGCGGGATCATGCAGAGTGATCACGTGGAGACACCACCTCCGTCTGCCATCTTCAAGAGGAGT
GCGCTTGACAACATGCGGAGGAAGACAATGCAACTCGATACACACAGAACCCACGACAAAGGAGAAAGCCCGCTACTGCAGCGTTCGATATCTCTGGATG
GCGTCCTTCAAGCCCAGAGCAGCTCCAAGCACCACGCTACATCGGCGCTACATTTGCATCAGACTTCGAAGCATGACGCCGCAGTGAATCACCGAGGTGG
TGATCATGACGTGACAGACGTAGATCACCTCAACGGCAAGAAACAAGAGAAGGAGAAAAAGAGGCATCGTCACAGGCACAGACAAGAGCTGGATGAGACC
ATTCCCGTCGACAGCATCAATACCGAACCGGTATCGCTGAACGGACGACAGATTCTGCCGCGATTCCTAATCCCAGAGCCGCGTATCCCTCTGAAGGTGC
TTAAGGCACGTCGGAACCACGACCAAGTTGTGCAAGCCGCGTTCCAGCGCGAGGTGGCCAACATCGAGCAGGCG