Description :
From Genome Similarity Track
Location :
Scaffold_251:49929- 54767
Sequence
4838 bases(100 bases per row)
GAAAGTAAGGGGAGAATCTCCTCCTGTGGATCAGAGAAGTGAAAAAGGCCATGAACTCCGCTATTCTCCGGTCGGAGCAACAGCGAGTTGGGATGGATAT
CTCTAAACTGGGTGGTAGAGCCAAAGAATGGGCTCTCACGTGTACCAGGTCGGTAGACAAAGTTTTCCCCACATAGAGTTTGCTAAAACAGCAAATATGT
TGGGTGTTTGCTTCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGTCAGGGTAAGAAAGAACTATCGGACTATGTCCAGGAACTGA
AAACTCTAATCGCTGCCTTGCAGCTTGATCCCTTACCAGAAATGGATTTGATTACCATATTTATGGAAAGCCTTCATACGGGCGTGGCTCGAACGGAAGT
ATTCCGGGTGCACCCCACCTCCTTTGAGGCGGCTGTGGATAACGCGTTGAACGCTAAGTTCAACTTTAAGGAAGCCCGTTTTGGCACCCATGGGTACAAT
CCGAACTCATTTAGTTCATCCAATAGGCCGGAGCCTATGGACCTCAGACTCGCCGAGACGGACGAAGAAGCAGAGATTTAATCTGTGGAACAGCATAAAA
ACATTCGACGTTGTTTCACGTGCGGAAGCACAAAGCATCTGCGATCTAATTGCCCTTTACGCATTGCACGCCAGGCTACTTCAGGACAAACCCCCGCCGC
TATCCAGAAGCATATTACGGTGCGGGAAAACATAGACTCCCAGTAGGCGCGGGGCACCCTGCTGGGGAAGAACTAGGTTCTGTTGAGCCTCTAGTAGGTA
TGGCAAACAGAATGTAGCTTTAAGGAGTCCCATGCACCCTAACTCGAGGCGTGAATACAATCCAGGCTTGTTGGTTGCAAAGTCGACTGTTAAGGGCTTT
GACAAACAATGGTCAATTTTGATCGACTCCGTAGCATCCGGTAATTATGCCAGACGCTGTTCACTTGAATAAAATCCATGTTATGAGTCGCTAAAAGCGC
ACAGGGGTGATACGATCACTGTTCGCTTAGTGACAGGAACACCAGCCACCGCACCCAAAGTTCCTGTGAACTTGAGTGTGAAGTTTTTCAATTTTAATAT
TATCGAACGCTGTTTAGTCCTTTATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTGGAGCGCCATGAGCCATGGATAGACTGGAGGTCG
AAAACATTAGGCGCCACGCGCACTACCTTTTGCGGAGCTTTGGAGAGTCATGAACCCACCTCTGCTAGGAATCAGAAGCGTTATTGGCTTGAGCCACTGG
CTGACAATGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGGATAGAACAAAGCTCGATATGTGATAGTGA
AGCGGCACGTACTCCGCTAAGTGGTAGTCGTTGTGAGAGCAACGTACTTAATGCTGAAAGCGTTGTTGACCAAGCGTCAAGTCATCGAGAGTTGAACCCA
TCAGATGAGCGTGAAGTGGCACGTAAGTACCCACTGTGTGACGTTGGCTGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGTTGGTGAAATACTAA
GGCATACCGAGCCCGGCTCAGCGGATGCACGTGAAGTGGCACGTAATCCACGTGATGACGACGTCATGTCTAATGACTCGTCATCGGATGTCAATAGTGA
CGTCAGCTCTTGTTTAGAGAAAATTACGTTAGATGATGGTATCGATCAGAGGGATATGAATCACACAACGTGTGATGTGTCACAAAGTGATGATGACTGT
CAGCTTTATAAACTCGTCAACGGAGTGACTGGCGTCTGTGATGGTACAATTAGCCTTGGGGCTTTACCTTCACTAAGTTCTCTTTTAGTAATCGAAGAGT
TGTCGGTCGATGAGTTTGATCACTCACTAAATAACGGAGACATTTCAGATGCAGTGGTCATTCGGCCTGACACCATAGAGTTGAACTCTTCTTCACTTTA
GGATAAAGCCGTTCTAGAGGACACAAAAGAGGCACTTAGTGCGCGTAGTGGGTCATCAATATTGAAATACCTTCATGATCTCTTTTATTCTTTAGTCAAG
GAATTTAAAGATGAGGTGTGCCGCGACCTACCCTCGGTTCTACCTCCAGATAGAGGTTTCTGTCATGAAATTGACTTGGTTCCTGGGATCAAATACTGTG
TCTTACGAGAGTAACTCTTACCTAAGGAGAAATGTGATGTCATTGATGACTTCTTCCCTGCCAAGCACGAGGCAGGAATGGTACATGAGAGTAAATCTCC
ACATTCGCCACCGACATTTTGTGTCAAAAAGCCGAACGGTAAGTAGCGTATTGTGCATGCTTATAACAAGCTTAATGCGGCCTCTATTCCGGCACAGACA
CCCATTCCTCAAAAGGATGTTCTCCAAAACAACATGGTTGGTTGTGCTATGTATAGCGCACTCGAGTTGGTCGATGGATATTATCAATTGCTCATGCTAT
CGAGTGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATGGGAATGGCTAGTGATGCCCCAAGGGCTGTCTAATGCTCCGGCTATATTTAA
TCGTCTGGTGATGCAACTTTTCCGCCCACATCGGAATTACGCACATATGTACTTTGATGACATTTTTGTCCATAGTCGTGCAACAGACGGTCGGTCAGAT
GTTGACAATCATATCAGAAATTCGCGAGCCGTGCTCGAGTGTATAGCGCGCAAATAAATTGTACGACAACGCGTCTAAATGCATTTTGGTGTAGGAGAGA
TTTCTTCTCTAGGATGTTTCATTGGTAATCGCGGCCTCAGAGTGGGTCCTGCTAAGCCTAATTCTATAGTGAACTGGACGATTCATAAGAATAAAAAAGA
CTTGCATAATTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAAATTACGCTGCTACGGCTCGGACATTAATTGATCTCCTTAAAAGGGACGCA
GATTGGCTCTGGGACAACACCCATGCTGACGCAATTCGGGCAACCAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTT
TTAGCGTTGTCTGCAATGCATCTGACTTTTCCATAGGCAGCACTCTGTTACAAACAGATTCTGCAGGCCGCGAGCGAGTTATCACATTTATATCTCGTCA
GCTGAAAACTTCTGAAAATCACTATCCAGTTTGTGACAAAGAGATACTTGCTATGAAGTATGCTCTCGTCAAATTTTGAGTCCATCGTCTTGGCTCCGAG
CCTTCTTTGTCTACACAAATCATGCGTCATTACGTACGGCGACACAGTCACCTCACCTCTCTTAGAAAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATA
TAACTTCGAGGTGAAGAATAAGCCAGCCAAACAAAATGTGTTTGCAGATGCCCTCTTTCGCCGACCTGATGATGAGCTTGCTCATGTCACGACTTTTTCG
TCTCATTTTGAGGAGCTCATTCGTGTGGCATATCCGCGGGATCCTCAATGTCTGGCATTGTTGCATGCCCTTGGGAGTGAGGAATACAAGAACTCGGACT
GTCAATTATCGGCACGCTTGCGGGCCAGCCTGCATCGATATTCCATCGATAATGGTCGCTTGTGCTATCGCACAGACGTAGCGGATACCGTTCGCATTGT
TGTGCCTCACAATGAGGATTTAAAGTACCGAATCCTCTTTGAGTCCCACGATACTGCCCTCAGTGGGCATTTGGGCTGAAAAAAGACTTATGGGAGGTGT
GAGTCAACACTAATGGTGGCCCAAACCCTACAAATGGGTGAGCACATACGTGCGTACATGCGACACGTGCCAGCGAGTAAAACCCTCGGCACATTCGGCT
GCGCCACTCGCCAGTTTACCCGTGCCCACGGGTTCTTGGGAGCCCATCAGTATGGATTTTTGTTTGGTCTTCCCAAAGACTGTGAAGAGAATATGGGAAT
TGTGGTCTTTGTTGACCGCTTAAGCAAGATGGCTCACTTTTTTATCGGTAGTGCCGGATTCCATCGATAGCAAAGGTACAACTATGGTGTTTATCGATCG
TGTGTTTCGTCAACACGGGTGGCCGCTGACAATCATCTATAATCGCGACCCTCGCTTCACTGGCAAGTTTTGAGCTTCCATCTTTAAGGTGCTTACCAAG
CGATTAGACATGTCCACAGCGGACCATCCGCAGACCGATGATTAGACTGAGCGAGTTAATCGCGTCATTGGCGACGTTCTTCGTAGGCATTGTGCTAAGT
CGCCTAAGACTTGGAGCTCGATGCTCCCTGCCATTGAGTTTGCGCTGAACAACGCTGTTCATGCCTCGAACGGCTTTACTTCATTCTATGTGAATAGATT
CACGCACCCCCACGTTCCGCTCACGTTACCACTCCGTGATTCTGGGCTTGGTGGGGGAGTGTCTGCTGACAAGTTTGCTGAAATCAGCCCTACCACGATG
CAGAAAGAAGTGAGCAAGTTTCTCACGACGCGCTTTAGTATCTTACGACGTGTGCGTGATGCAATGGCTGATAGCTAAGACAAAAAAAAAGAACAAGCTG
ATGCTAAAGGCAGAGGATGTATTGATTCCTATGAAGCTGGAGATCAAGTCTTATTAAATGCTGAAACCTACCTACAAATGTAGTGTCTGCGGTCTTCAAG
ACGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGATCATAGCGAAGAAAGGCTTTGCCAATACACTCAATCTCCCGCGCAAGTTGTGCACACAACCAG
TGTTTTACCCTGGCTTGCTTAAGCCATATCATGGTCCT