Description :
From Genome Similarity Track
Location :
Scaffold_178:49926- 50954
Transcript NameFunction/comments
g5351.t1hypothetical protein

Sequence
1028 bases(100 bases per row)
TCCACGACAGCATTACAGCGGGACCTGGCTCAATTCACAGGCTGCTTCAATTTAAGTATGATGTAAAGTGCCCATTTTCAGGGATCCCGTTTTACTTACT
TATATAAGTTAGGCTTGGATCTAGCGTTAGTAACCTTCGAAACGCGAAATTGTGGGACCAAAATGGGCACTGTCAACTCGAACTGCCACGCTCCCGAATC
AAATCTCTCCCGTCTCTATCGGCTCCACCCAACCATGTGGGGGTCGCCGTGTCAATGGAGCAGATCCACCAACGTGCTGGTGTCCTCGCTCATTCTTCAT
TTAGCAGCGCGGAGTGAAGTCAAGCATGAAGGTTTTCCTGCCTTTGACTGTCGCGGGACTGTTGTTGGCCGTTGCCAATGGCGACCTCTTGAAGTCCACG
TACACGGGCACCAAGGGGCTGCATGAGCTGGCCAAGGCCCAGGGCAAGTACATGGGCACGGCCACGGACAACGGCGAGCTGACGGATACGTACTACCTGG
CGGCGCTCAAGGACAGCAGCGAGTTCGGCATGCTCACCCCGGGCAATTCCATGAAATGGGACGCCACGGAGCCCACGCAAAACACCTTCACGTACACAAA
GGGCGACGCCATTGTGACCATCGCCGACGCGATGGGCGCTCAGGTGCGCTGCCACACCTTGTTGTGGCACCAGCAGGTCCCTTCGTGGGTGCAGAGCCTC
AGCAAGGCCGAGATGTTGAGTGCACTGGAGAACCACATCACCGAGGTGATGACGCACTTCGGAGACTCGTGCTACGCCTGGGACGTCGCTAACGAAGTGA
TGGGCGACGACGCCACGTACCGCAAGTCCTTCTGGTACAACACAACGGGCACGGACTACATCACGACGGCCTTCAAGACGGCCAACTCGGTCAAGAAGTC
GCTCGGCCTCAGCACCAAGCTGTACTACAACGACTACAACACCAACACGGTGAACGCCAAGTCGACGGCGGTGATGGATATGATCCAGACGCTGTTGCTC
GACGCCAATATTGGTATCGACGGAGTGG