Description :
From Genome Similarity Track
Location :
Scaffold_2:499255- 501804
Transcript NameFunction/comments
Phypa_INRA-310PPTG_02205phospholipid-transporting ATPase

Sequence
2549 bases(100 bases per row)
TTTTTCTGACCAGGAATATACAGTATCGGGTTACGGAGAACTTGTTCGGGGGCGACATCCTCGTCAAAAACGCCGATCGCAATGATTGGCAACGCCAGGA
AGAAATTCCACCCAGCCATGACAAAACTCTCAAACACACTCGTACCTGACTGTCCATTGTAAAAGTTGAAAAGGAACAGAGCGATAACGAGTGCGACATT
CTTGTAGAACGAATAAAGAATGACCTTGGAGATTCGTTGGTAGTTATAGCGACCGTGGACAAGAAGCAGTCGTTCGAGAAACCGGAATTGGGCTATTGCA
TAGTCACTCGCATTAACAGCTTGTACACCCTCTTGGCCTGACACTCCGATACCAACGTGAGCGGACTGAATCATATTCACATCATTGGCTCCGTCACCGA
TGGCCAGTGTAATTGGCTTTTGTGGTGAGTTATACCGAATGAGGTTAACAATATCCGCTTTTTGAGCAGGGGAGACTCGACATGCAATCACTGCATGGCA
AACACTGGATATATCCAGCAACATTTGGGAGAGGACCTTCGCCGCATGCAGTGCCCGCTCAGACGACGTGTTCTTCGGTGGGAACACGTGAACCATCGCC
TTGCCATCACACACAAGCGCGAGATTACTGGAAACCGTGTTGGCGTTCAAATGTGACTGCACATCTTCCAGTTTATATATTGTGTCAACTTGTCTGCCTA
AATCGTCGAGGTCCTCGCAATTGATGATGAGAAGTTTCATTCCTTCATTGATCAACTGGCAGGCATGGCCGATGTTGATTGCAGTTTCCTCCTTGTCACC
CGTTAGCATCCAGATCTTTATTCCGGCCTGAGCAAGATTTGCAATCGCAGCGGGTACACCTTTCTGTAATTTATCTTCGATTGCAGTCGCCCCCACAATT
TTCATTTCGGTTTCGATCAACTCAGCCACTTGTTCTAAAAGTTCATCTCGATTTGTCAGAGAAGTCACAGCTTCCTGGTATTTAGCATCCCAAGCCAAAT
ACTCTTCTGCGGTTAGCTCCTTGCTGCAGATCACCAACGTTCGAAGTCCTTCACTAGCAAATCGCTTCAATTCCTCATCCATTTTAGCGGTATACTGGTC
GACTTTACTGCGAGGCATCATTACATTGTCTGCACCCTTGCAGTACAGAAAGTATCGCCCGTCTTCGGTACGTAATGTCACGGACATTCGCTTTCTAGTG
CTGTTAAACTCGTTCACATTGAGAATTGAGTACTTACGCATAGTCGACGACCCGTTCTTCTTAGTCACTTTGACCTCCAAAAGTGGTGCTGGTGCGTAGA
AATTGTATCCTAAACACCTGGCAGCTTTCACTAGAGCTTCTTCATCCGGAGAAGAGGCGCGATAGTCGATCTCACCGGTTTTCACATTCTTTTCAGGGAT
CACCGTGTGGCACACGGAAAGCACTGTCAGGAACTCATCGATGGCTGCAGCCTCCGGAGCATTCGTGGCTAGTGCATTGATTAACCGTGGGTCATCGAAA
TGAATGAGAGCGTTGAAATCAACTTGAGCGTCTCTAGGATCGTGGTGCTTGTCGTCTTCTTTATCATTCGAATCGATGGTTAACCCCTTAGCAGCAGCAT
TTTTCTTCGCCATCTCGGCAACAGCTCGACCGATTTCGGTTGTGCCGAAACCATACGATACACCAGCGATGAAGCACTTTCGGAATTCCATGATGTTACA
AGTGAGAGTACCCGTTTTGTCGCTGAAAATGTGGTGCACCTGTCCTAGTTCTTCATTCAAATCGGACGTCCTTGCATTCGCATACGTTCCTTCATGGCAC
ATCTCAGGGTCGCTGGCAAGGTTTTTCGCTTGGAAGACCTTCACCATATCCAGCGATACGTACAGCGAAATAGGAACAAGATTGTTATAGAGAATGAGAA
AAGTAAAGAAGCTCACCAGGTTGGAAGCAGATGACGTCCCTTCAAAAGCGGAGCTAAAGTACCAAAGATTCTTCTCATACTTGTTCATCCAGATCGTGTT
GCAAATTGTGCTGATGATACAAAGCACGAACTGCGTGATGAAGATCAGCAGAATGCAGCGGTTGACGACCTTGTACACATTACTCTGTTTGGATGGCGTT
GAGCGAGCGTTCTGCATCAATTTGGTTTCGGAACCAGTAAAAATGACGATCCCGTAAATGTACGCGCAACCGCGAACACTGCAGCCACGCAGAATGATGT
TGGAAGGGCCAATTGGAGCTGCCTCCTTGTTGGGCCCAAACTCGATCCTGCCAGTGAAGTTGTACAGGCGATTATTGGGTTGTTCATACTCCATCGTAGC
ATTCAGCTTCACCGTTTGTTTGCTGTGATCACTCTCTGGCAATACAGGATCGTTTAGCTTCCTATAGCCAACGTGTTGTGCCACTTGCTCGATGGCAGAT
CGTCGCTTCAGATTCGTCTCACCGTCCAAGTTACACGTTTCAACAAAGCATCGTCCTTCTTCCTCGGACGTTGAGAGGATAAACACGTCTGCAGGCGCTT
CATCACGGTCACCGAGGCGTAGAATATCCCCAACTACCACTTCTTGCCA