Description :
From Genome Similarity Track
Location :
Scaffold_251:49925- 54835
Sequence
4910 bases(100 bases per row)
GAGGGAAAGTAAGGGGAGAATCTCCTCCTGTGGATCAGAGAAGTGAAAAAGGCCATGAACTCCGCTATTCTCCGGTCGGAGCAACAGCGAGTTGGGATGG
ATATCTCTAAACTGGGTGGTAGAGCCAAAGAATGGGCTCTCACGTGTACCAGGTCGGTAGACAAAGTTTTCCCCACATAGAGTTTGCTAAAACAGCAAAT
ATGTTGGGTGTTTGCTTCGCCTAATCAGGCATACCGGGTGCGTTCTCGTTTCCTATCTGCCCGTCAGGGTAAGAAAGAACTATCGGACTATGTCCAGGAA
CTGAAAACTCTAATCGCTGCCTTGCAGCTTGATCCCTTACCAGAAATGGATTTGATTACCATATTTATGGAAAGCCTTCATACGGGCGTGGCTCGAACGG
AAGTATTCCGGGTGCACCCCACCTCCTTTGAGGCGGCTGTGGATAACGCGTTGAACGCTAAGTTCAACTTTAAGGAAGCCCGTTTTGGCACCCATGGGTA
CAATCCGAACTCATTTAGTTCATCCAATAGGCCGGAGCCTATGGACCTCAGACTCGCCGAGACGGACGAAGAAGCAGAGATTTAATCTGTGGAACAGCAT
AAAAACATTCGACGTTGTTTCACGTGCGGAAGCACAAAGCATCTGCGATCTAATTGCCCTTTACGCATTGCACGCCAGGCTACTTCAGGACAAACCCCCG
CCGCTATCCAGAAGCATATTACGGTGCGGGAAAACATAGACTCCCAGTAGGCGCGGGGCACCCTGCTGGGGAAGAACTAGGTTCTGTTGAGCCTCTAGTA
GGTATGGCAAACAGAATGTAGCTTTAAGGAGTCCCATGCACCCTAACTCGAGGCGTGAATACAATCCAGGCTTGTTGGTTGCAAAGTCGACTGTTAAGGG
CTTTGACAAACAATGGTCAATTTTGATCGACTCCGTAGCATCCGGTAATTATGCCAGACGCTGTTCACTTGAATAAAATCCATGTTATGAGTCGCTAAAA
GCGCACAGGGGTGATACGATCACTGTTCGCTTAGTGACAGGAACACCAGCCACCGCACCCAAAGTTCCTGTGAACTTGAGTGTGAAGTTTTTCAATTTTA
ATATTATCGAACGCTGTTTAGTCCTTTATTTGGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGCTGGAGCGCCATGAGCCATGGATAGACTGGAG
GTCGAAAACATTAGGCGCCACGCGCACTACCTTTTGCGGAGCTTTGGAGAGTCATGAACCCACCTCTGCTAGGAATCAGAAGCGTTATTGGCTTGAGCCA
CTGGCTGACAATGTCAGTGTGCTGGACATCGGAATGTCAGAGTTAGTTGATTCTGACGATGTCAAAGACATGAGGATAGAACAAAGCTCGATATGTGATA
GTGAAGCGGCACGTACTCCGCTAAGTGGTAGTCGTTGTGAGAGCAACGTACTTAATGCTGAAAGCGTTGTTGACCAAGCGTCAAGTCATCGAGAGTTGAA
CCCATCAGATGAGCGTGAAGTGGCACGTAAGTACCCACTGTGTGACGTTGGCTGTGATAGCGACGCGCTGAATGTCAATATTGACGTTGTTGGTGAAATA
CTAAGGCATACCGAGCCCGGCTCAGCGGATGCACGTGAAGTGGCACGTAATCCACGTGATGACGACGTCATGTCTAATGACTCGTCATCGGATGTCAATA
GTGACGTCAGCTCTTGTTTAGAGAAAATTACGTTAGATGATGGTATCGATCAGAGGGATATGAATCACACAACGTGTGATGTGTCACAAAGTGATGATGA
CTGTCAGCTTTATAAACTCGTCAACGGAGTGACTGGCGTCTGTGATGGTACAATTAGCCTTGGGGCTTTACCTTCACTAAGTTCTCTTTTAGTAATCGAA
GAGTTGTCGGTCGATGAGTTTGATCACTCACTAAATAACGGAGACATTTCAGATGCAGTGGTCATTCGGCCTGACACCATAGAGTTGAACTCTTCTTCAC
TTTAGGATAAAGCCGTTCTAGAGGACACAAAAGAGGCACTTAGTGCGCGTAGTGGGTCATCAATATTGAAATACCTTCATGATCTCTTTTATTCTTTAGT
CAAGGAATTTAAAGATGAGGTGTGCCGCGACCTACCCTCGGTTCTACCTCCAGATAGAGGTTTCTGTCATGAAATTGACTTGGTTCCTGGGATCAAATAC
TGTGTCTTACGAGAGTAACTCTTACCTAAGGAGAAATGTGATGTCATTGATGACTTCTTCCCTGCCAAGCACGAGGCAGGAATGGTACATGAGAGTAAAT
CTCCACATTCGCCACCGACATTTTGTGTCAAAAAGCCGAACGGTAAGTAGCGTATTGTGCATGCTTATAACAAGCTTAATGCGGCCTCTATTCCGGCACA
GACACCCATTCCTCAAAAGGATGTTCTCCAAAACAACATGGTTGGTTGTGCTATGTATAGCGCACTCGAGTTGGTCGATGGATATTATCAATTGCTCATG
CTATCGAGTGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATGGGAATGGCTAGTGATGCCCCAAGGGCTGTCTAATGCTCCGGCTATAT
TTAATCGTCTGGTGATGCAACTTTTCCGCCCACATCGGAATTACGCACATATGTACTTTGATGACATTTTTGTCCATAGTCGTGCAACAGACGGTCGGTC
AGATGTTGACAATCATATCAGAAATTCGCGAGCCGTGCTCGAGTGTATAGCGCGCAAATAAATTGTACGACAACGCGTCTAAATGCATTTTGGTGTAGGA
GAGATTTCTTCTCTAGGATGTTTCATTGGTAATCGCGGCCTCAGAGTGGGTCCTGCTAAGCCTAATTCTATAGTGAACTGGACGATTCATAAGAATAAAA
AAGACTTGCATAATTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAAATTACGCTGCTACGGCTCGGACATTAATTGATCTCCTTAAAAGGGA
CGCAGATTGGCTCTGGGACAACACCCATGCTGACGCAATTCGGGCAACCAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTAC
CCTTTTAGCGTTGTCTGCAATGCATCTGACTTTTCCATAGGCAGCACTCTGTTACAAACAGATTCTGCAGGCCGCGAGCGAGTTATCACATTTATATCTC
GTCAGCTGAAAACTTCTGAAAATCACTATCCAGTTTGTGACAAAGAGATACTTGCTATGAAGTATGCTCTCGTCAAATTTTGAGTCCATCGTCTTGGCTC
CGAGCCTTCTTTGTCTACACAAATCATGCGTCATTACGTACGGCGACACAGTCACCTCACCTCTCTTAGAAAATGGCTCGGTGGCTTTCCTTCTTTGCGG
AATATAACTTCGAGGTGAAGAATAAGCCAGCCAAACAAAATGTGTTTGCAGATGCCCTCTTTCGCCGACCTGATGATGAGCTTGCTCATGTCACGACTTT
TTCGTCTCATTTTGAGGAGCTCATTCGTGTGGCATATCCGCGGGATCCTCAATGTCTGGCATTGTTGCATGCCCTTGGGAGTGAGGAATACAAGAACTCG
GACTGTCAATTATCGGCACGCTTGCGGGCCAGCCTGCATCGATATTCCATCGATAATGGTCGCTTGTGCTATCGCACAGACGTAGCGGATACCGTTCGCA
TTGTTGTGCCTCACAATGAGGATTTAAAGTACCGAATCCTCTTTGAGTCCCACGATACTGCCCTCAGTGGGCATTTGGGCTGAAAAAAGACTTATGGGAG
GTGTGAGTCAACACTAATGGTGGCCCAAACCCTACAAATGGGTGAGCACATACGTGCGTACATGCGACACGTGCCAGCGAGTAAAACCCTCGGCACATTC
GGCTGCGCCACTCGCCAGTTTACCCGTGCCCACGGGTTCTTGGGAGCCCATCAGTATGGATTTTTGTTTGGTCTTCCCAAAGACTGTGAAGAGAATATGG
GAATTGTGGTCTTTGTTGACCGCTTAAGCAAGATGGCTCACTTTTTTATCGGTAGTGCCGGATTCCATCGATAGCAAAGGTACAACTATGGTGTTTATCG
ATCGTGTGTTTCGTCAACACGGGTGGCCGCTGACAATCATCTATAATCGCGACCCTCGCTTCACTGGCAAGTTTTGAGCTTCCATCTTTAAGGTGCTTAC
CAAGCGATTAGACATGTCCACAGCGGACCATCCGCAGACCGATGATTAGACTGAGCGAGTTAATCGCGTCATTGGCGACGTTCTTCGTAGGCATTGTGCT
AAGTCGCCTAAGACTTGGAGCTCGATGCTCCCTGCCATTGAGTTTGCGCTGAACAACGCTGTTCATGCCTCGAACGGCTTTACTTCATTCTATGTGAATA
GATTCACGCACCCCCACGTTCCGCTCACGTTACCACTCCGTGATTCTGGGCTTGGTGGGGGAGTGTCTGCTGACAAGTTTGCTGAAATCAGCCCTACCAC
GATGCAGAAAGAAGTGAGCAAGTTTCTCACGACGCGCTTTAGTATCTTACGACGTGTGCGTGATGCAATGGCTGATAGCTAAGACAAAAAAAAAGAACAA
GCTGATGCTAAAGGCAGAGGATGTATTGATTCCTATGAAGCTGGAGATCAAGTCTTATTAAATGCTGAAACCTACCTACAAATGTAGTGTCTGCGGTCTT
CAAGACGAAATTGCGTCCGCGCTTCATTGGGCCGTTTACGATCATAGCGAAGAAAGGCTTTGCCAATACACTCAATCTCCCGCGCAAGTTGTGCACACAA
CCAGTGTTTTACCCTGGCTTGCTTAAGCCATATCATGGTCCTTCTCTCGTGGACCGGAAGGCGCTTGCGCCTGGAGGAGAGACATCATCCCCGCTAGCTG
CATCTTCGTC