Description :
From Genome Similarity Track
Location :
Scaffold_738:4991- 6013
Transcript NameFunction/comments
g17096.t1hypothetical protein

Sequence
1022 bases(100 bases per row)
CGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCCAAT
ATTATAATGCGAGGCCTCTTATTGGCTATATAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACACCACATCGGAATTAGCGGAC
TGAAATCACTGATGCTGATTGGACAAAATAAACCGCCTTTAACAACGCTTCTTTCCACGAGTTCCCACGCCTGGCGCTTCAGTCCGTTCTGCAAACATCT
CCTACAAGTAACAGAGTAACCTGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCCCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCT
GCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATAATGCGAGGCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAAT
GCGTAAAGTGGACTACACCACATCGGAACTAGCCGAATGAAATCGCTGCTGATTGGACAAAATAAACCGCCTTTAACAACGTTTCTTTTCATTCCCATAC
GTGGTCGAGTTTCAGGGAGGCAAATTCTCCAGGTGGCGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCAAACTGTGGCCACT
TTTCCATACGGTGCGCCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAG
GTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATTAAGATTCCACGTGACATGCTCATCGACAACCCGCCGGTGATCCAGATGA
GGACGAGGAGATCCGTCCGGGAGCTATCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGT
ACTTTGCGAGTCGCACCATCCT