Description :
From Genome Similarity Track
Location :
Scaffold_1:499045- 500526
Transcript NameFunction/comments
g158.t1XP_002904418.1 Major Facilitator Superfamily (MFS) [Phytophthora infestans T30-4

Sequence
1481 bases(100 bases per row)
TGGGGCCTGACGGAGCACAATGTACAGCTCGTGTTCCTCTTCACGGTGACCTACTGGTCTGCCAGCAGGTACGCCCCAAGTGAACTGACACCCTTTCCTG
CATCAATGCTGACCTTGTCGTAGTATTATTTCGCAGCAGGTGCTATCGGGCTACGTGTACGTGTTGACGGCTTCCAACGTCCCTGTGGGCTTCGTCAAGG
GCATTCAGGGTCTAGCCCAGCTACTGTGCGCATTCCCAGCTGGTTATGCAGCGGACAGTACACGTCGAGACCGGATCCTCGCGCTTTCAGGCGTTCTCGG
CGTCGTGGCTTCGGTGCTGACAGCGTTGGCTTTCGAGTTAGGCGACATGGTCCTCATTTACGTGGCTTTCGGACTATGGGGGGCCTTCACTGCCTTCCAG
AGCTCGGCCATGGAGGCTCTGTTCGCTGACTCGGTGCCGGTAGGGCAAAGATCAGCGCCGTTCACGCTGAAGTACGTCATGCGCAACGTCGCGCTTGTGC
TCGGGCCTTTGAGTGCGATGCTGTTGCTATGGAAGCACGGTGATGCGTGGACGCTTGCAGCACTGCGACCCGTTCTGCTTTTCGGAGCGTTCATCGCGGC
AGTGTCCATGGTCGTGCTGTTTCAGTTCAACGACGACCTAGCATTTGAGAACCGGCAGTACGTGTTCGCTATCGAGCGCGAGCTGAGCTCCATCGAGCGC
AACTTCACATCCGAGTACAGCGAGAGAGAAAGCTCCGCCTCCGAACGAGGAGGGAGCTTTTCTCGTGTGCACATGCCCTCGACAAGCGAGTTCTCTCAAC
TTCTCCGGTCTTCAAGGGTTCCTTCAGTAACCAGCGGCTACTACTTGGCTGCTCCAGTGCGGAGTGACGATGGCGAGGATGTCCCGGTACGCCCCGTCAT
GGCGTGTTGCGGGATGCTCGACACTGCGCACGTCCCGTACCTGCTGTTTGTGTCGGACTTCCTTGTGAGCAACGGCACCGGACTTGTCACGGCGTTCTTC
CCGCTCTTCTTTCTCAACGAGTACGCGCTGTCTCCGGTTCGAGTGCAGACCCTCTTCGCACTGCAGCCACTGGTGATTGCACTGCTGTCGCTCCTAGCGC
AAATGGTGTCGAGCGCTACTGGGCGAATGTCCATGGTCGTGGCCACGCGTGCACTTGGCACCATCAGTTTGCTGCTGATGGCAGTCTCGCACGACGTGAC
CGACCAGAGTGTGCTGTTCCTAGCGCACGGAGCGTTGATGCAGTGCACGGAACCACTCCGGCGATCACTTCTCATGGATTTCGTGCCCAAGACGCATCGT
GCGCGTTGGAATTCGCTGGAGGGACTGACTGTTGCCTCTTGGGCAGGTAGCGCCGTACTCGGTGGAATGATCGTGGAGGCTTACGGATACCGACTGTGCT
TCGTGGCGGCAGCGCTGGTGTATACGTGCGGTCTCGCCCTCGAGACCATGCTCATTCCTCTAACACGGCATGCTGTAGAAA