Description :
From Genome Similarity Track
Location :
Scaffold_443:499- 2404
Sequence
1905 bases(100 bases per row)
ACCATCAAGTCTCGGCACAAGGTACTTGAAAGAACCTCCTCGGATTGACACGATCTCCGATCGACGTAGGAGGAAGAAGTACGCCAAGCACATCACCCCC
CATAAAGCTTGCTCACGTGGTGTAGCCATCGTCAAGCTGCGAAAGCAGGCTTCCAGAATGTCGAGTGAAACCGGTTCCTTACGAAGCCGCGGTGTATCGA
GACGGCTGATACCTTTGAGAAGCATGCGGATGTCTGGGTGTGCGATCGGGAAGTCGTAATTGAAAGCGGCGAAAAAGTGTCGTACGCCTTGAAGAACCGC
TGCAATGGAATCACTACGGATTGGACCGCCGGATCCGAAGCCGAACTGAAAGCCGTGGAGAACGAAATCTGAAATATACTGCACTTTCCGATGAATGGAG
ACGTCGAGAAGATATGGGTGAGCGCCTCTGCGTGAGATCCAACTGGTCCACTTGCCTAGGGATCGACTGTACTGCACAAATGTGGAGTCGGCAACGGAGT
GCGCGCGGAGATACACTGCTAGACGCTGGTTAGGCTTTGTATATCCACCGGCGGGGACACCTGCAATCAGCCGGAAGTTAGCGACGTAAAAAGATCCACA
AACGACGCGTTAGCGGTAAGTCGGGAGCCAGCATCTGCTCGGACGTTGTCTGCGTCGGGTATGTGGGACGCAGAGAGCCACGGTCGAAAAGTTGATTCCC
ACCAACTTAGCAGGCGAATAAGAACTTGAGCCCTGGGATTGCGAGATGCCAATTTGTTCTGCCACGCGACGGCAGATGTGTTGTCGATGCGGAAGTGTAC
GTGCCGCGGCCTCCCAGTAATGCGAGCGTTTGAAGCCCACCTTGCGCCCCATGTATGCACAGCGAAAGCACACGAGAGAAGCTCGCGGAAGTTGATGTCA
AAACCTTTGTCTCTCCGTTGTTGAACGCCGCGATGAGATCACGCTCGGACAGAGTGAATTGGTACGTCAGTGCCTCCTTCGCGGATATGTCAAGTGCGCA
GAGACCGAAATCTGAAGCATCCGTTTCAACCACAATGTCCGGAGGCGGAAGTGCGTTGAAATACGCTAGCGAAACGCCGTTCAGGTGAGGGGTGCGCAAA
ATCATCCACCACCACAGTAGGTCATCCTTCATTGTAGAAGTCACGGGGACGCTCTGGAAGCGGTTGAGCCGAGCCTCGCGGACCCGTATGCGCTGTAAAA
ATGGTCTAGCGGCCCGAATACATGTTGCCACATGGCGTAGACTTCCGAGCAGGAACCGGTACCCCTTGCGGGTGAGTGAACTTGCGACGTAGGCGGAAGC
TACGATTTTGCGGGCTTTGTCGATTTTGGCTGAAGGCATTGCAACAATTTCTGCGATTGTATCGAACTCGAGTCCTAGAACGCGCTGGCGCGTCTTCCAG
GGAGTAATCTTCTCAGTGTTGATAGCATCGACACCCAGGACGGCGACCATGGCAAAACGGAGAGAACGATCCATGTCAACGCATGTGGTGTCAATGTCGG
CAGCCACGTTAATGTGATCGTCTACCCAGTGATAGTTGAAGAAGCCACCAGGAGAAACTGCATTCGAATGACCGCCGTGAATATGAGAGATCGCTCCGCC
AAATATCTCGTAAAAGCCGGGAGATTCCGTCCAACCGAAAAGGTGCTGATAACTCGATGATCTATGCGTTTCTTCTTTGATAAGACCGGCAAACAAGTAC
ACACTGTTGCTGTGGATGCTGATGTGGCGGAAGGCAGATGCCACGTCAGCTGCCATTACACGGACAACCGCACTTGGAAAATCTTCTTTCGTTTTCAAAA
TTGCTCGCGCTACGGCATCGCAGTGGTGTAGTCCGGCTTAGTAATGCTGTTTTGGTCCGTGTAGTCGTTGATCAAAGTACCATCCGGGTTATATATAGTC
GTGGA