Description :
From Genome Similarity Track
Location :
Scaffold_3462:499- 1670
Transcript NameFunction/comments
Phypl_g15846hypothetical protein PHYSODRAFT_491362

Sequence
1171 bases(100 bases per row)
AGCTAAAGTCTACAACAAGCCGCAACAGACACCAGACACAAACCAAAGAGGTGAGGACACAAGCAAtgagccaccagcaaagcgacgccgtgcagcagca
gcagcagaacaaACCTGAAGGACGTCTGGTTCTCATGGTACGCCCAAGAGCCCCGCATATGGAGCTCAACCGATGGCGCCACCAAGCACACGAGATCCAA
CGCCAAGCTTGTCGTGGCTTTCTTGAAGCTGTTTCTCTCCGATGGCTTCGTGCTTGACGAGAAGTCACCGCAGTACCGAGACGATGTACTGGAGCTCGAT
GGAACCCCTGAGAAGAAACTCCTGTTGTTTCTTGGCGAGCACAAGATCATAGCCCGCGGGTCTTAAAACGTCCTCAAGTCCATGCGCAAGCTTCACAAGG
TCGGCCATCTCAACGCTCGCATCCAAAACtacaagcagcttcaagccgCCGGTCGCATTGGTGACCCTGCACCTGTGCATACTACNGATCTGTACTTGTC
TTGATGCTTGTTCTGCCGCTCGTCACTTTGTTTTCGACACTCCACCACGCACTGCTCTGTCATTATGCCTCAGCCAAAGCCTACCAAGAAcgccgtcagc
tccgcgAAGGAGTTCAAGATCCTGTGCATCGCTGCGAGCAAGACGTACAAAATTCGAGTGAATAATGAGGCCATCCGTCACCTGCGACTTACCATGAACA
CGACGGTCGCCTCCGCAAGCCTTCTCCCCGAAGCGATCCAAGTCATCATCGCCTCTCTCGCTGAACGGAAGACGCGCAGAATCGGCCTTGAAGACGTGCG
CCAATGGCTGGNCGCAGAATCGGCCTTGAAGACGTGCGCCAATGGCTGActcctcctgcacctgcggacgacgaagactcggATGAAGAGGAGCGGAGCC
CTGACAAAGACCTCAAGGATGAACCCGTGCACTATGCCCGCAAGCTGCTAAACTGGAAGCGCGAAAAGCGGGTGACTTACTACCTCGTGGACTGGGAGCC
GActtggacaagaagacggcgttCCTactcgaaggcggcgacgagcttctGGTTCATGTGGGCCTTCGGCACGGGTGTATTACAAGCTTAGGAGTCTGAA
GGAAAGGGATATGAATTTGTAGCACCGATTGAACCCTAACCTTAACCTCCGAATAGAACAGCAAAGTTAAC