Description :
From Genome Similarity Track
Location :
Scaffold_3:498888- 503731
Transcript NameFunction/comments
Hyaar_Emoy2800609ATP-binding Cassette (ABC) Superfamily

Sequence
4843 bases(100 bases per row)
ATGGTCTCGAGCAGCGACTTGCAGCAGTGACGCGGCCATCAAAGTCGCGCGCGCTACTCACATCGTGGCGACAAGTGACGAACTTACTCTGGAAGAACCT
CGTGATCCGACGACGGAAGCCCGTGTCGTTCCTGCTGGAGCTCTTCCTTCCCGTGCTCTTGACACTCGCGTTGGTTTTTATTGCCAATGTCGACACGATC
TTTGACACGGGAAACCCCTCGGATGGTTCATCGACAGAAGCAGCAGCAGCAACGACGGCGACGTCCCAGACCTTTTTGTGTACGGCACTTGATCAGAGGA
CGGATTACGGGGCACTGAGCACCAACATGTCGACGTTCTACACGAGTGGACAGAGTGTCATTGGCCTCTTTTTACTCGTGAGCTATATGAAGTTTGTCTC
GACGACTACGACGACCATGGTGAGTGAAAAGGAGACACGGATCCGAGAAGTCATGAAGATCATGGGGCTCTCGAACTTTACGCTCTTGTGCTCGTGGTGC
CTCACGACCGTGATTTTGACCACGCCACTCGCCTTTGTCCTTGCTGCAGAGCTCAAGTTTGGCCAAGTGTTTCCCATGACAACGTACGCGACGCTGGTGT
TCTTGTTCTGGACGCTGAGCTTGTCGATCGTGAGCTTCAGCTACTTTATTACACCCTTCTTCAACAAGGCAAGAGCAGCTTCAATCGCCTCGGTGTTGCT
CTGGCTCCTGCTGTTTTTCCCGTTCTTTTCCGTCATGTCCAAGTCGAACGCGACTAAGTATCTCGGCGCCCTGGCACCTCCTACTGCCTTTGCCCTAGGA
ATTGATGACATCGTGCGCCACGCTCAGCTTGGACGAGGAGTCGCGTATGCAATTGAGATTGCAGAGTCCCCAGTTACCGTGCCAACAGCATTCGCAATGA
GCTGGTTTTTGATATTGGACTCGTTCATCCTGGTCGCTCTTGGTTGGTACTTCGACAATGTACTTCCTCAAGAGTTCGGTATCCGCAAGCCGTGGAATTT
TCTCTTCGTGAAGGACTTTTGGCGTCCTTCGAGTTTAACAGCGGTCGACAGAGACGTTGTGGTACTAAAATCTCCTTCCATGGACTCATCGCCTCGGGCG
TACAAGTCGTTTGCATCACCGCAAGGAACAAGGTTGTCGCATCAGACTTCGACGAATAGATCGCCCGTGATGATGAAGGATCGACCTGAAATTGTGGCTT
GTGTGGAGCCTGTTGATGCCACGTTGACAGCACAGGAACGGAAAGGAACGTGTCTCCAGGTTCGAGGCCTTTGCAAAGAATTTGCGCTGGACAATGGCGA
GGTAAATGCAGCAGTGGGAGGACTTGACCTCACTTTGTACACCGGGCAGATCACGGCGTTGCTTGGCCACAACGGCGCTGGAAAGACAACCACCATTTCG
ATGTTGACCGGCCTTATTCCACCCACGTCGGGCAACGCAACGCTTTACGGTCTCTCCCTTCGCGAAGACCTGAACGAGCTTCGCCAGATTATGGGTGTTT
GTCCTCAACACGATGTCCTATTCGACGAACTGACCGTTGAAGAGCATTTGTTGCTGTTTGGAACGATGAAGCACATTCCGCGTGGCAGTCTGAAGATGGA
AGCGGAGCGGATGATCCGGGAGGTGGGTTTAACGGAAAAGCAGAAAACCGCTGCTAAGGACCTATCGGGTGGACAAAAGCGCAAATTGAGTCTTGCATTG
GCCTTCATGGGGGACAGCAAGCTCATCTTTCTGGATGAGCCTACGTCTGGTATGGATCCGTACTCCTGTCGGTTTACTTGGGACTTGCTGCAGCGAAACC
GGGACGACCGAGTTATTCTTTTGACCACGCACTTCATGGACGAGGCTGACATTCTAGGTGATCGCATCGCAATTATGGCTGACGGTCAGCTTTGTTGCGC
CGGGAGTTCACTTTTTCTAAAGAATCGCTATGGTGCTGGATATCATCTGACCATGATCCAAGCGCCCGGATGTGATGTGGAAGCAGTGGGTATGTTTTTG
CGTGGCTTCGTGGCTGAAGCAAAATGCTTCAGCAACTTTGGTTCCGAAGTTGTGTTTCAACTTCCGTCAAAATCGGTAGGAACGTTTTCAAAGATGCTGC
AAGCTCTCGACGATGAAATGCCCCGCTTGCGCATTGTCCAGTACGGTGTGTCTGTAACAACTCTTGAGGAAGTATTCTTGCGTATCTCACGCGATCGAGA
AGAAGAAGCCGCCATAGACGCTGCTTCGTGTAGCGTGGAAACAGTCAACCAAATTCGCAAGACGTCAGCAAGCTCAGCGTATTCTCGCAGCACGGTGACG
AGCCCGATGGCCATCGAAAGTACTAATGGGGCGACGCTGTGGACCCAATATAAGGCACTGCTGACAAAGCGTTTGCGTATTGCGAAGAGGGACAAGAAAA
ATCTGTTGAATACCGTCTGCATCCCGCTGCTTTTCCTGATCATCTTGGTGTCGCTTCCCGATATCGATGTTGCCAGCTTCATGCCTACCGATGACTACGC
GACAGAACTTGCGTCACAAGGGCAGTGCACAAGCGAAAGGTTTTCGTTGGTGTCTGCTTCAAGCTTTTGTGACAGCTTTTCGTTTACCTACTGTAAGCTG
GACGTGATTGACTGCAGTGCCTCGACATGCTGTGACCCGAGAAATGTCCAGTCTCCGTACTACGCGTGCAACAGGTGTGAGGGCACCTCGTCGACTAACG
CAGTAACGCCGTGCTACAACAAGCACTGCCTCGACGATGATGGTGCAAGGCTTCAGGTCACTCTGAATGCCCTTTTGACATCCATCGTGGTGATGCTGGC
TTTAGCTTTTGTTCCTGCCGCGATTGTAGCCTTCGTCGTACGCGAGAAAAGCCCAACTCAGAACGCGAAGAGTTTGCAGCTGATTTCGGGTGCCAGCGTG
TCAGCGTATTGGTTGTCTACGTGGACTCACGATTTCCTTATCATAATGGTGACCGTCGTTGCCTCCATGATAATGATTCCCCTGTCCGATCGAACGTTGA
AGGGCTCTTTGGAGGTGTGGGGAGTCGTTTGTTTGGTTGGTTCGCACGCTCTGGTCGTGATCCCGATGGCATACTTGTTTTCGTTCAAGTTCGAAAAACA
TGCAGTGGCACAAACATCGCTGCTAGTATTTGCCCTCTGCACGGGTGGATTGCTGAGCATTTTCTCGTTTTTGTGTCGACTCATCGACTTTGACTTAACC
GCGAGCAGCTCCTCCAACTTGACTCTTTCATCGCTGGACAGGAACTACCTGCGATGGATTTTTCTGCTTTTCCCAGGTTACAGCCTGAACAGCGGTGTTT
ACGAAATTGCTACACGAAAGCTGACCCGACGTTCGCTGTACGGTAGTGATACCGAGAGAGCAGCCCCGCCTTCGTTCTTTGGTCTTTGGGAAGGTCTTGG
GACGGACTACACATGTGAGTCATGCTGGGATGCACCGGCTGGTGCACCTTGTTGCGAGCGCAACGTTTTCGATGTGGACGTGGCTGGGGCCCCTATTGCC
TATGCTGTGGTCGAGTTCGTTATTTTCATACTGTTAGTGTTTGTAATCGACAACCGTAGCTTGTCGTGGCGCCCTGAACAACGTCAGCAGCAGTCTTGCA
ACGAGGATGACGATGTGGCCACTGAACGCCAAAGGGTGGAGCAGTCGCTTCCCACCCAGAACGACAGCGTGTTTATCCGTAACTTGCGTCATGAGTATGG
ACGTAAAGACAAACTCGCATTAGACAATTTGTGCCTCTCCGTTGCAAGAGGGGAGTGCTTTGGATATCTTGGCATCAATGGAGCTGGTAAATCGACGACG
ATGAAAGTGCTGACTGGTGAGATGGCCCCGACAAACGGATTCGTTACACTTGGAGGCTACGATTTGGCTCGCGATCGCAATAAAGCGCGTCGTGTGATCG
GATATTGCCCCCAATTCGATCCATTGCACGACTTGCTGACTGTGGAAGAGCAGCTTGAGCTGTATGCTCGGCTCAAAGGCATCTCAAGTGATTGCGTCGA
CAACACTGTTGACCAGACCATTGAAAATATGGGACTCACTGAGTACCGGGCCAAGCTGACGCAAGGACTTAGTGGAGGCAATAAGCGTAAGTTGTCAACA
GCCATCGCCATGATTGGCGATCCAAGTGTCATCCTTCTCGACGAACCTACGACAGGAGTAGACCCAAGTTCTCGACGGAAAATGTGGGATGTCATTGCTA
ATGTCTGCGCAACCAAGAAATCCTGCGTCATTCTTACAACCCATAACATGGAGGAATGCGAAGCACTTTGTACGCGTGTAGGAATCTTGGTGAGTGGACA
GCTGAAATGCTTAGGAAGCGTCGAGCATCTTAAGCAGAAGTTCGGCCGAGGGTACATCGTGGAGGTGAAGTTGCAACAACGACCTGCATTTGTTCTGGAG
TCATTACAACGAGATGTGTATCAAATCCTTGGAGACAACAGCCCTGGTATCTCACGACACCATATTGCGAGTCTATGTTCGTCCCTTGAAGTTCCAAAGC
GGGCGCAAGAGATCCTGGATGGCGAGAACAATGGCAGGATGCTCACCAGCTACTTCGGGACGTCAGGCGTGATCCCCGCCGACATCTTTTGCGCGTGGTG
GGCGACTGAGAACATGTACTCGACGCTGCAAGAATTCTTTCACGAAAGGTTTCCAGGTTGCCAGCGTATCGAACACCAAGGCGGCCACTTTCGTTTCCAA
GTACCAAAGCAATCTTTGCGACCGTACGCAATCTTTGGCCTCCTTGAAGAAAACAAGGAGATGCTGCACGTGAGCGAGTACGGCGTGAGCGCAACGTCGC
TGGAATACATTTTCAACGAAATGGCTGTCCAACAACAAGGAGA