Description :
From Genome Similarity Track
Location :
Scaffold_57:49886- 52377
Transcript NameFunction/comments
Sapdi_VS20SDRG_13182hypothetical protein

Sequence
2491 bases(100 bases per row)
GGGAGGGCGCGCCGCAGACGATATGCCGATGGATGCAATGACGTCGCCTCGTCAATCGCTGCTTGCGTTAACACGAGCGTGCGCCACGTCTTGATGTCAA
ACACGTAGAGGTCACTCTTGTTGCGGCAGGCGAGGAGACCGGTCAAAGCTGCGGACGCAAAATCGATGAAGTAAATGCGGTCGTGGACCCAACCTTTTCT
CTCAAAGAGGTACTTGGCACTGCACGAGAGGAGGTGCGAGTCGCGCTCGTCGAGGGGCACACGGGGACGTCGGAGTCTCACAATTGTAAACAGTAGCGTC
GAACCGCCCAGTGCGATCCCAACCAGAAGACAAAAGCGACTGAAGGAGCCAATGGCGACGACGCCGCTGTGGCACACCAACTCAAAGTCCATTTCAACTA
GCGTACATGATCGCTGGATCGTGGCGCTGTGCGAGACGGGACTCGTAAAGCTGAGGGCAGCAACAATGAACCACGTGAGGATGGACGCCTTGAACGCGTA
CGCAGCACTGAGCTCTTGAGTCAGTGGCATGCAAATGTCATCAAAGATGTAGACGAGCCAGCCGACTTCGCCGGCCGCGAGGATCTGCGTCACAATGACA
ACTGCCTCCGAGACATCGCCACGGGATGATGTCAAGACAGTTGTGATCCCATTCTTCTTTAGTTGGAGCGTCGCTGTGCTCAGAATACACAGCGCGGTGA
AGCTGCGCGCCAAAAGCAGCGGCCGGCCGACCCAGACCATGCCACCGACGCGGTTGACCTTGAAGAGGTTGGAGCCTTCGCTCAAGCTTCCATCCAAAAG
TGCGTATAATGCGGTGACAGAAGCGAGGGCCACGAGCACGAATGAAATGTACTGACAAAGGCCCCGCAGATACGCAGCAACGTTGCGCGGTACCTCGATG
CTACTTGCTGCAAACGACGCCGCAAATGACACTGTCGAGAGGAATGCCACAGTACTAGCGTCGCCGTCAACCCGAATGGCCTCTCGCCCACCGACGACCC
AGTCGTAGGCAAGCGCATAGCTCGTGTACTTCATGGTCGCATCGAACGGATCAAAAAGTCGCTGATGGAAGATCTCTACGCCGTTGGTCGGTACGTGCCG
AGCGTATTGCGTGATGCCAACCGAGGTGGCCATGACGTCGGCCTCGATGGCCATTGCTCGCGATCGGTACGCTTGGAGAGTGCTCGTCGCAACATATTTC
GATACAAAACGCGACACGCTATCGAGAAAAGCCAGACACAGAGTTGGCACCACCGCTTCGGCCGCACATGCTACCGGAATCAACGTCGTCGGGTCGAGTG
GGATCCCAGCGCCAAAGACGCTAAAGATGGCTTGCATCGGAGAGACCGAGACCCACTCGTTGAAGCTCGAGTAACATGCCGCGTCGGCGCCACCAAACTG
CCAGAGACCGTACGAAAAGTTGAAGTCCCGAGGCACTTGGCCGCAGAATATGTTGCCGCTCGCGCAGAGGTACATGTTTCGATCGAGGCGGCGTGGGACG
GGACTCATCGAGCTCATCAAAATGAGGTTGGCGTAATCTTCTTGAGCGTTCGAGCTCGTATTGGCGAGTATGACACCGAGCGCTTCACGGATATCGCGCA
CCAGCATCGCAAGCGACGGCGGATATTGCACGTGGTACATGTCCACCGCACCAAACGGGCCAATTGATTCGCTGAAAGCGCGTAGGGCCCCATCGAGTGG
CGACTGCAATGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN