Description :
From Genome Similarity Track
Location :
Scaffold_28:49884- 59261
Transcript NameFunction/comments
Phypl_g1152conserved hypothetical protein
Phypl_g1153hypothetical protein PHYSODRAFT_507179
Phypl_g1154hypothetical protein PHYSODRAFT_354853
Phypl_g1155eyes absent family protein

Sequence
9377 bases(100 bases per row)
CGCTGGGCACGCGATGCAGTGGCCAGgagcgccgtgctggacctgCACCCAGGTGATGCTGAAAGGTGGTCGCGCAACGAGCGCTTGCCAGCGCAAGGCT
TTTCCGAGCACTATACATGTTCAGTACGAACGACATCGCCTCGCTGCTTGGTtcggcgtcgcgctcgcacACGAATACCGACGATGCGTCTTCCGCTCGT
TAGCATTCGACTGTCACCACCGCGACGCGGCGCGGCCCGAGCCGATACGAACACGCACATGCAGCAGTAGCGCATGCACACACATTTAAACTAAAAGTAC
AGCTAATGTATATGATAAGACTTGAACACCACAGAATCCCCGTTGCTGTTAAAGGTCAAAATGGCATTAGTTCCTACATCTCCTCGCTGTAAATAAAGAA
GAGCTGGTGGACAGGCGGGCACTGCCCAACACACCGCCCACGCGAAGAACCAAAGCAACGAGCCGACTCACCTCCGGCATCCGTCCTATCCCTGGTCCCT
CCAGCCTTCAGCCTCTGGAACGCCGATCGACCCCACCACTCGATGACTCTTGACCCTCCTCGTCGCGGCGAGCCGCATACAGCCGCCAAGCCAATTATAC
ACCATATGAATAATGCAGAGCCTCCCTCTGCTGCCGTCGGCCGAAGCACCTCTCTGTCGCGAGAAAGAGAGCGAGCCCCGCGGCTCGAGCTTCGACCGAC
TGAACCGGATCCCCGGGCCACCAACTAATCATCCAACGCACGCTTCACCAAATAGTCAAACTTTCTCTTCATCCACCAGGCGAAGGAGACGTTGCATCGC
GCTTGTATTGATTCCCGAGGGCCAAGTAACGCAAAGGATTCCAACGCCACCAGACCCGTCAGCTTCCCCCGTCCACTTCCTCTTCTCCTCCAGTCTCTCC
TCCCCCAGCTCCCTTCTCCTGTGTCGttccgtgtcgtcgtcccACCATCACCATCGCCAACTCATGCCAGTCGCATAGGCAAGGGCGGAGCGACTTCCAC
TTGGTCGACCCCTCCTTTACTTGTTCTCTGTCTCCACCTGGCGCAGGTGAGCAGAGCACAGACCTTTGCGTCGGCACGGCTTGTTGCATCCCTCCGTGGT
GCAGCGCTTGCCACCGCCGTGTGTGGCACACAGGCCTCCGCCGCGGTCATTACGCATGCAGCCTGGCACCTCGCACAGACGCGAGCCGCCGTGAAGCGCG
CAGTAGTCGCCGCGCTGCGTACCCTTGTCGCAGCCGTCGAACatgcagcgcttgccgccaCCGTGCGAGCGGCAGTAGCCGCCGCCTTGCgagctgcgag
agcagcCACCAAACTGACAACGCGGGCCACCGCCGTGGGCCTTGCATAAGAAGTTCGACTGAGCGGCCTTGTCGCAGCCTtcgtggctgcagcgcttgcc
acCACCATGACGGATGCACAGGTTGCCGCCCTGCGAGCTCTTGTCGCAGCCCTCCACggcgcagcgacgaccgccgccgtgcgagaTGCACAAGCCgttc
gagcgcgagcgcttgTAGCAGCCCTCGCTCTTACAAAGGCGACGGCTCTTAACCTCACCGGGCTTGACAATGATCTTGGGGCCCGCCATTTGCGGCTCAG
CGCAACGCGGGGTCATCATGAGCTCCGAGTCCGTGAAGTCGGTCTCAAGCGACTCCATGAGTCCCTCGATGGGGGAGCCGGCCAGCACGTTCAGGTTCAA
GATGCCGTCATCGATCTCGGCggtcttcttggacttgtcCTCGGGGGCGTCCACCAAAAAGCTGTACAGAATCGACATCTCCGTaccgtcgaagccgtcg
tccAGGTTCACGAGGTCGGGCTTGTCCTTGCTGACGTGCTCCAGGTCGCCGGGCATCgagaagtccagcagctcttccagctcctgggcCTCGAAGTTGg
gctgcgcgacggcggcgctcaccTCGGGCTTGACCTCGGCGGgggccgcggcggccgcgaaCTGATCGCTGGGCATGCCCATGCTCAGGAGGTCGGCCGa
cggggcggcggcgccccAGGGCACGGTCGGCAGGTTGTTGTTGGTCTTGGGGAACGACACGAAGGGCAGCGCCGGGGGCGGCGCCGCCATGCTCAGCATG
TTCATGCCGCTCGCGCCGAAGCCCATGTCTCCGGCGGTGGACCAGGCGGGCGCGTGGCCCACGGCCTTGGCGTTCTGGCTCAGCATCACCTTGCTTGGtc
cggcggcggcggcgggctgGTACCccgcgaacagcgcgacggcggccggGCCCATGGCGCCCAGCGAATCGCGGGACTCTATCGGCCGGCACATTTCCGG
GCTAGGTGGGCGTCAATGGTGTTCCTGTTTTCCTGTTTCGCTTCTCGCACTTCTCTCGTTTGCGTTCTAGTGGCCTGGCGGCTCCCTGTGGGTTTTCTCC
CGCTTGCTTCATCCCGGTAAAGGGCTAGGGATGGCGCTCCCGACGGTCGCATTGGCGCATAATTGGCGCCTGCTGCTTTTTCGACCAATCCCGGTCCCAA
CCCATCGAGCCAGTGCGATGTGCAAGAGGTCGAGGGAGGCGTCTGACCTTCCGCTGGGCGCGGCTTGACTTGTGCCCAGTATGACGGGCGGGAGACAGGG
GGGCCGAGAACACAAAGAAACCgctccacgctgctggaggacagAGCGCAATGAATGGTGGATACCGATACAATTTGTATGGCGAAAGCCAGGATTTGCC
GGCGATTTTTGCGGTTGATTTCGCCGGCGAGCATTCAAGCCTCTGCTCGTTCGTTCGTCCTATCCGAGCGATTGTCGTCCCTGGAAGAGTTATCAGCGCG
GATTCACCGTCCCCCGTCGGACGGGCCGTCCCTGGTGTCGGTAGTACTAGGCGTTGCCTGCTGGCGTGCGTTGGCCAATACCAGCGGTAATAATGGCGTT
TAACTCATCGTGCAACGGCGTTAGTGCCTGCGACGAGAACCAAGTAGCAGATGGGGGTGAATGCCGCCGATGCGCAAGGGTCCCGCCGCCGCAAGCCAGC
CTTAAAATTAACGCTAGTTCCATTGCGCTACCGGTAGTTTCATGTTATCTGACAGAATTAGAAAGATGCAAGTATCAAAATTATTCCTTGATGCTGTTCG
ATAGGTTAACAACTTTCGCGTGATTTTGCGATCGTGAACTTCGCGGTAAGTATTGTACTGTAAAATTAGCTCCACGCTAACAGACAATTATACTGTACAC
CAGAATAATACACAGTTCCTGCAATACACGCAGAGCCGCCACCGCAggcaagcagcgcggccaccACCGAGAGAAGCCTTGAACTCAGCACTTTCGCGCA
CTGCTAACTTAGCGCCGacggcggctgcggccgACGGCCGACCTCCACAAAGACACGCAGCCCGATCCTATCGCCGATGGCAACCGGGTGGACCACCTGA
ACCTCGCATGTCGTACACACGATATACTGATGTGGCACACCCATATTTATGTACGACTGATGGTGCCATGCTGATCCGGATCATCTTGAAGCCATCCGCG
AGAAGGCATGGAGGCCCACGTCgacatcaaggagaagctgctgcccaagaTAGAGCCGATCGCAcctcagcggcagcgccaacgAGTGGGCGGGCAGTCC
CCCACGGCCGCCAAGCCCGGCGCGACCAACGTCCCACCCGTGcggccggcggcggctcccGTGGGCTGCGGCTGCACGGGCCGGCTGCACTTGGCGGCTT
GGCTGGTCTCCATCTCTTCGTTCATGTGGGgcttcagcgccgccgtgctcaaCGTCTGCATCGTCCCGGACGCCGTCGGGTCCATACTCATCGATATCAA
TCTCAGCACCGAGGAGCAAGAGCGCGCCACGGCGCTCGTCGTGGTGGGCTGCGTGCTCTCCGCGCTCACCAcgggcggcgtcggcgcccgTATCGGGCAG
AAGAAAACCATCCTGGGCAGCAATGTGCTGTACGTTATTGGCGGCGCGATCTGCGCGCTTGCCACGTCCAAGCGTGAGCTCTACGCCGGTCGACTGCTCA
TTGGGCTGGCGTCGGGCGTCGTGACCAACACGGTGCCCATCctgctgacggagatctCGCCCGTTGTTTCGCGCGGCGAGATCACATCGCTCCACCAACT
CAGTCTCACGATTGGCATGCTAGTGTCAGCTGTGATgggcttcttcatcatctccaATGTGCCTTCGGGTTGGAGATATCTCAACGGATTCATGATCCTG
CCTCCGTTGGTGCAGTGTCTGAGCGCGTCGTTCGTGCCGGAGAGTCCCTGGTGGCTAATGAAGAACCGTGGGCGTGACGAGTGCCGCGCGACGCTGGTGT
TTCTACGTCCGAGCAACCAGAAGGATGCGATTGAAACGGAAGTGCAGGAAATCGCACGCGTGATggagcaccgccagcacgagcCTCACGTAACCTGGTC
GCACCTCCTGGCGCACAAGAAAATCATGGTGACGGGCACAACGCTCGTGTTCTTCCAGGCCATGACAGGCATCAACACGGTGATGCTGTACTCAGCCAAG
ATTTTCCACTTCGCAGGAGTGACCAACCCATTTTTCGCCACAGCCGTCGTAAGTTTCACCAACGTGGGCGTCACCATCATATCGGTGCGCTTTGTCGACT
CGTATGGCCGTCGTCCGCTTCTTATCGTGGGCACAACTACTATGATTTTTGCTCTAGGAGTACTCAGCTGGTCACTGCTCTACCTCAACGCCAATCTTGA
AGTCCAGGGTACGGTAGCTGTGATTTCAGTGCTCACGTTTGTTGGAGGATTTGCCGTGGGTCTTGGTGCTGTCGTTTGGTACGTCTTCCCATCGTTTAAA
TTGTTGATTGCCGACCATTGTATTTACTTCAGTGTGCATGGCTGTTGCCGTACAGGGTCATGCTGGGAGACATTACGCCTGTGCACATACGCTCTCGAGC
GTTCGCATTCTACATGGTCGTCAGCTACATCTGCAACATCTTAATTGCTGTGTACACACTGTCTGCCATCAGCTTTTTGGGCCGAGGCTCCAATCCCGAG
AAAAATGGCATCGCCAAGCTCTACCTAATCCTCAGGTGCGTCACGAGGGTTAAGATAGATTCCTTGTGCTTGCTGCATACTACTACATGTAGGAATTGCT
AACAAGCGTCTTGCTGCCGTTGTATGCTTCAGTGGTGTTGCTGTCGTGTGCCTAGGGTATATCTACGGCTTCGTGGAAGAGACCTCGCATATCAAGACAG
CACCTGCGAATGTCGCGGATGATCAAAAGTCACTCTTAGCGGAGGAGGCTCTGGATGAGGAGTTCGGAATTCCGCGCCAAACGACCGATCTATAGCTGTT
GCGCAAGAAGATACTTCACATTACAAGTGCCTTGTGCACACAATATGGATCTCTGCTTCAAAAGCAGTCGTTGAAGCGGCTCCGTAGTAACGAAAGTCGA
TCGCAATGATAGCAATTGTCATTTTCCCTCAATGATGCCCGTAGTTCCATTgccgtcctcttcctctAGCAAAGTAATCACTGCTTCAGAAgttgtgcag
cttcagcaatcTCACGCACAGCTTTGGCGACGGAGATGAGGCGTTCGCTGTTGTCGTTGGGTGAGAGCGAGTTGGTGAGAGCTCCCATTTTCTGCATGGA
CGGCAAGGAGAGGACACACGTCGCAAACGTTAGTACATCAACAGGTTTCGAGCAGAGGGTGATCCGCCGTGCTGAGTTTGGTTTGTTGGCTTGCAGACAG
GCAAAGATCGGGCTGGCGGTCCATGTGATCGTGCCTCAAAACTCTCTTGCGTAGCAATAACCGCAGAGGCACTACGCCGCAGTCATACGGCAGAACCAGC
CCCAGATTGGAAGAAATACGGATGTTCCACCTGATAAAGCGCAGCGAGTGTCTGGCGACGGATGGCGTTCACTTCCGCATCACTATCGGAGCCGGTAGCC
CTCATGGCACTGTCCATCTTGCGCTTCGCTGTACCAAAAGCACAAGCCATGTTAGCCTGATCAATCCTGTGTCGGTAAATCTAAAACCACTAAAAAGTGG
CCCCGTAGCCACACCATACCAGCTCCGTGCGCTGTCGTAGCTcccttcgccttcgcctgctccagctcctgcatctcTCGGGCTTGTTTGGCTTGCTCTT
CCAAatggaactgctgctcgatgcgGTGTCtgcgctcttcctcttctttctTCGCCGCCGCAAGTTCGTcagcctcctgctccgcctgctgtttcttggc
ctcctcctcagtGACAATGAACTGGTCGCACCTCACACAAAACATCTATCACCGACACAGCACACTCAGCATTAGCTGCAGAACGGTCACCACTGCCTCC
GAAACACTAAGCTGGAAGTTCCTCCCCACCTTGCCCTGCTTGTTGCGCATCAGCGGCGTGTAGCAGTCTTCCACAGGACAGCTAGTGCCCAGCATCGTCC
ATCCCTGCAGCGTACCAGTCCATACACACAACCCACAGTCTCTCAGCACTTGCTGCGGAGCTCCTCAACTGCCGCTAATGCCACCGACCCGCAGCATTtt
ctcgcccagcagcttgctggcTTCATcgcgcgagcgcttcacgGGTGccgtcgactgctgcacgcAGTAATACACAGACGAATGGCCGGCGTCAGCCATC
GCCCGaagacagcggcgacgaaCGTCGAACCTACCGCATCCATTGCTATTTGGCTAATCCTGTCGAAGTTTATAATGCTTTTAGCGGGGAATGTTTTTTC
CCCGCTAAAATAGCTAATTGAGCGAGCCATGGAAGGAGACGCCTCGAGCACCGTGCGCGTGTGTCTGACGCGCTGCCCGCTGCCGCCGGCCGAGGAGAAC
GTGCACTCGCTGCCGTGCCACATCCATTTTGACGGGTCGGCGGCCGTCAAGACCTTCTTCCGGCCGCAGaacggcgacagcaacagcaacagcaccgaCC
ACGGTGGGCCGGGCaccgaggagcaggacgtcacggcggagacggagcaACAAAGCAGCAATGACAAGCTGCACGCGGAGTTCCGCGGCATTCAGTTGCA
GGGCGAGAAGCTTCAGTTGGCGCCCCTGGGGTTCACCGGTGCGTTTGGCGCGTTAACCTGCGGGTGAGTCACTCGCTTTGACGGTCGAGTTGTGTGGGAC
TTGCAGGCCTCGTGTTGGAGGACAGTGGCATGCGACACCCGGAGGACGAGGGCCGCGTGTGGGAGGTCGAGGACCAtttcgacgagctcacgTGGTGGTA
AGTCGCGGGTTGCAGTGCCTCATAGCGTCCGCGATGGATCGCTAACGTCGGTTAACGCGCTGTTTGTTGCCGCCAGGGACGTGCCGAACCACACGACgag
cgagacgcagcagctgccgctggtgctgcagcaatggCGCGATCTCGCCTCCGCGGTACGTGCACCGACTGGTAGCCAGTCGTCTTCAGCCAACGGTAGT
GAACGCTTAGGCTGACGCTTTGTTCTACTTGCTTGCGTAGATTCATGACGCGTAGTTGAAGGATccggcggcggtggcagtAGCACAGTCAagcagcccc
gctgcagaCGACTCCGCACACGCAGGCAGCACTGCTCGGCTACATGTAATACTCGCTTCAACTCTGTGCAGCAACATAGACATCACACTGGCCACCGACT
GTACTGGTCCGCGTCACCAATCCAAATCAACCAGTCTTTGCATGCCGAGAAACAGCTTCCGGTGGTAGTAGCCACCGTCGTGGACAGTCTCACCGACGAC
GTGCATGTGTCAGAAGGCCATTCGCAGCGAGATCGCTCCTCGACGCGGCATGCTGGCACGCGGGCCACCCTCACCATGGGCTGCGACTCAATCGCACACG
CTCGCGACGAGgaacaagacgctgcagctgacgatggcggcgctaCGCGCGCGGCTCGGTGACgccgtggcgaagctggtgctgctgcccgtggtGGGCG
TGAGTCTCTGCGGGGTCGTGACGCTCCTGCTCGGGCTGCAGTGGGTGGAGGCGCTTCAGCGCCAACACCAGGCGCTCAGGTGGCGCGCACGACTGTgggc
cgcgctgctggcgctgctgctgccgtccaagcagctccaggcgGTCGTGACACCGCATCACCTGCCGGGGGCGGGGAAGAGTCCGTCGAGTGAGCTGGAG
AATGGCACGAGCAAGCTGCTCAACAGCGGGGACAAGAGAGACGCCCACGAGGGAGACGTCGATGGGGAGGGCGACGGGAGCTACGCCTCGCGCCCCTTGA
AGCGACAGAAGTCGGAGCCTGGAGAAAGAGACGTGGCTGAGACTTCCCGGCAGCAAGAGGGTcgggacgacgacgagggcgaccaaggacaagctggaga
tgaagaggacaaggaggaagGGGACGAAGAGACCCCAGCTGAGGCGGTGGAGCCTAAAGGCCCCACAAAGCCGCGCGTTCGGAGGCGCGTGTTCATCTGG
GACCTGGATGAGACGCTGGTGCTTTTCGCCTCACTGTACACGGGCACCTTCGCCCAGATGCACGGCAAGGAGGTGGCACCTGGAGTGGCCCTTGGCGAGC
AGATGATGACcttcttgctggcgatgctggagaagcatTTCTTCTTCAGTGACCTGCACGATGCAGACGTTGACCATATTGCGCACGTAGCTGCTGATAG
TGCCTCGAGGACATGCAATGTgcctgagcagcagcagcagcaatcaaCTGTACAAGAGAGATACGAGCGTATCCGTGAGATCTACGAACGTCGCGGACAT
GTGGATTTCCTGCACGATGCGAACAGTGAGTGGTTTGCTATCCGCGGCGCACTCATTGCAGCTATCGATAACTTCTCGACGGGCTGGCTGCACGAAGCTC
GGCAAGTGTTGGAGCTCATTGCAGAGTCTGCGCACTCCCGGGCACAGCCCGAACCAAATCCGGATACAgaaagcagcgacgacagtAAACAtgaggacga
agaggtgGAGAACGTGAACGTCCTGGTCACAAATACGCAACTCGTGCCAGCGCTGTGCAAGTGTCTCATTTACCAATTGGACGCGTTCTTCCCGATTGAC
CGCGTGTACTCCTCGGCCAAAGTGCACAAGTATCGGTGCTTTGAAACGATCCTGGAAAAGTATGAAGCACCAGACGTGGAATTTGTCGCTATCGGCGATG
gactggaggaggagcaggtAAGCCTCGCACTCGGTCTCGAGTTCCACAAGATTCGGTCGCTTGTGGACCTAAAGCGACTGCGCTACGACCTGCAGCTAGT
GCAAAATAACAGCAACAGCTCGACTCCGACTGCTGGGGTGACTGACTCgcctgctgttgctgcggcaCAATTGTCAGTTGCCTCCTCGCCCGTCGGCCAA
ACTGCTGTCGTCTAGGCATTAACCGCCACCTTCCTTCTCTTCTATATGCGCAGGAATACCAAACATTATTTATTCAT