Description :
From Genome Similarity Track
Location :
contig_45:498821- 504663
Transcript NameFunction/comments
g8155.t1hypothetical protein

Sequence
5842 bases(100 bases per row)
CAGAATCTTGTCTTCGATTTCCTTGAGCAACCCCTTGTTGCGTGCGTTCTGCACAATCAACTTGTTCTTTTGCTCTTCTAGATCAGGTCTTTCCTGCGCC
ACAACGATTCCCAAGAGCTGGTCTTCAAGACCGTGAGGCGTGATCATAAAGTTCAAAAGCGTCACCTTCACTGATACCTCTGGCAAATAGTGCGGGTTCC
GATACTTGGTCGTAATGTAGAAACGAAAGCTTTCTGCATATTCAACGGTTGAGTCACCGAGACGAATACATGTCACCCCACCCTGTTTGAACGTTTGTTT
TAGTAAAAGTGGCTCCAGTGACGGGTCCAGTTCCTCTGCAACGTTTTCAAGCAGCACGGGTGTGCCAAACTGTACTGAGTTCTCTAGAGTTCGCATATAG
TCACCATCCGTTAGCTTAATCACCGTCATTTGGTTGTCCTTCTCCATATTACGGATCCATTTGTTTGCTTGGCCCTGCGGATCAATCATCAGTGGCCATC
GACGCGAATTGAAGACAATGATGCCGTTATCAACGGAAAAGCCGTCGGTCGGAAGTCCATCAATGTTCCACTTGCGGATTTGTACCGCGTCGCCAAGAGA
TCCGTTCAGTGATGGCAGGTCACTGCAAGGAATGTCAAGCTGCTTGCAGCGTGCAACCCAGTCGTGTACGGCATCCTGGCGGTATAATGAAGTGAATGGA
CCGAGATACGCAACAACTCCTGCTGAGATCAGCACGTCTCCTGTCAGTCGGCTGTACTGGATTGCCAACTGCTCTGCAAACTCAGTCCAGCGTGTCTTTT
CTCCCCCAAGGCTTTCGATCAGCGTGGATGCTCGGACAAGCTTTTTACCCGTGAGATCCACCTGGTACTCGAGGTTTTCCTTTTGCTTAGTGGCGGAGTC
AAACTGCCGCTGTAGCTCTGCTAGCCCGTCCTCAACCTCTTTCAATTGTGACAACTTTTCGTTCAGCTTTTTCATGACCTCGTCAAGTTGCTGCTCAGCT
TCCTTTAGCGCTTCACGCTTGGGCGCAACCACCTTTGAAACGTTGTCGTACAGTGCCATAGCGTGCACCCATTTGCACAGGCCTGCTGCTGCTTTTGAGG
CCTTCTCAGCCTTTTCTGGACTGAAATTTTCATCGGCAATGCTGTTGACGATTTTCATCGTTTTGGGGTCGAGATTGTCCTTGTCGAACTTCTTCAACGT
GGTGATGAAGGTCGGGTCGCTAAGCATTTTCTGCGATGGCCCCCAGTAATCCATGATACGCTTAGAAGGGTCTTGCGGGTCTGGAATACGGGCTGGTTTG
ATACCAAGCATCACACAAACACCCTCGCACACCAGTTTCACACCTGCAGGAGGATTACTCATGGCTTTCACCTCGTTGATCTCACTTGGTTTGATAGTAT
CCAGGGCTTTTAGAGCCTCTTCCAGTGCTGGAATTGCTTCCGCTAGATCTGCTTCCACACTGGCCTTCTGCTGCTCGCACTCTGCCTTAGAAGCGTCGGC
CACTGCAACATCAGCCTGCACTTCACTTCGCTGCACTTCAACTCCAGGCAACTTAGCTTTGATTTCCTCCATCAAAATGTCTGTATCTTTCTTAGACTGG
TCCAGCACAGGTTGCAAGTCTTCGAGCTCCTTCCGCATCACCGCCACATTGTTTTCTGCAAAATTGATCTTCTCGAGACCAATAACATAGCGATTGCGAG
CACTTTGTACGGCTTCACGACGGCGCGCCAGGAAGCTTTTAAACGCCACGATGAGCTCTAAATAAGAGGTCGGGTCACGTAATTCTGGCGGCGCAAATTC
TTTAGGAACTTGTCCGAGAGTTCCATCACGCTTACGTGGAAGTATTGGCATGTGTCTACAATGGCTTTGCGAACGTTGGCGCTGTCCATTTCCACGTCTG
CTAAGAATTTTTCGGCCACAGCCACCAAAGCATCGGACGGCCACGCAGTGAACCAGTCAATCGTACAACAGTTAATTAGCGATGGAAACTTTCGTAGTCT
GTCCCTGAAGGCATCGCCGATGGGGGAGCAAGCGAGCACAATGTGCAAGTTACTTCGCACTCGCTGCAGGAAAAATGCATATAGCTGGGTTTGGTTCATG
TTGTCTCCCACTGCTTTACCGAGTTTTTCCTTTACATGGGGGCGACAGCTTCACAGATACCGACCCGTTCGTCATACGGGAACAGATTTGGAATCTCTCC
AGAGTTCAGCATATTGTTAATGTCTTCGACAAAGCCATCATACTTGATCTGCGTATCGCTAAACAGGAATACAAGTGGTCGCGCACCCGTACCAGCCATA
CGTAAGACATCCTTCATATCTTCACGCCATTCCGTCATGGTATAGTTCTTCGAAATTTCAATCTGCTTGATTTCAAAATCAACGATAAACGCCGACAGCC
GCGTAAGACTTTGACGACCACTGCCACCCACGCCAACAAGAAGTGCATTTCCACCCGGCATGTTCAGCACGCGAACAATCCGCGATAGGTGTTCGATAGC
GAACAGAAACATAACCAGGTTCATGGGTTTCCGACTAATGCCATTGTACTCGGCCAAGTACCCGTCAAGACACTGGATAAGCTGCGCGATACCGTCGAAA
TCGGTGTCCAGACGAACATCCACTTCTTTGTACAGCCTTGGACTTGCATCAGGGTCCATGTAGTCGCCAAAGAACAGGTTTCGCATATCAACTGCTGAGA
CTGGACCTTCACAACCGCGTTTGAGGCTAGCAAATACCTTGTCAAAGTTCGTAGCAAAGTGCTTGATAGTGATTTTCTTCTGCACGTCGTTAAACCACTC
CCGGTCTTCATCGTCGATCAAACGGTCACCGATCACGCGAAGGATTCGTGCACCCACAACTTCACCAAGCTGTTGGCATTAAACTGCTCGCTAGGCACCA
CAAGCATGATTCCTTGGACGATTCGAGAGAAATCCCGAAGGTTGAATGTATAATGCGACTTCTTTGGAGTGGGGAGGAGTGCACTCATAGCAGACTGATA
CAGCTCTAAAGTTGCAGACACCACGGCTTCTGAGAGGCGTTTCACCTCCGGGATGAAGGGATTTGAGCCAAAGTACCAATCCAAAATGGTAGTGAAGATA
CGCGTGAGTGTCGTGTCATCGAACTCGGAAAAGCACAGAAGGTTGAAATGGCGAAGTAGCCGAGGAGTGACGCTGTTTCTTCCGCCACCAGGTGGTCCCA
TCGCTGCTAGCACAATAGTGTCAACAATCTTTCTCCATGACATTTCTTTGAGATCGTAATAGCCTTCACTGTCTATCAGCTGCCTCACCAATTCAATAGG
TGGCTGAGCACCGTACGTTTCGACTAATGGCATATTCAGGTCGTCTACGAAAATAATGGCGTTCTTGCCCAGGGGTGGGCCGAACACACCCTTGCGGCGC
TTGTCGAGCTTTCCGTCGATAATATTCTGGGTCATGTTTGCCGACGTTTTTGCCGAGAACGACAGCATAATGACGGAATTGAGATCCTGAGGCAGTACCT
CGTTCAGAATTGAGGTCATGTAACAAGACTTGCCCGTTCCTGTTGGGCCACAAACAAGCACCTTTCTTTTGTTGGACACGAGAAGCTGAACGAGATACTC
CAACTGAGCGGTGAAGATTGTTGGCACAACAATTTGGTTGAACGGCGTATTGGGCTGAATCACGTATGGTTTGAGCATCTCCTCCCACTTGAACCACTTG
CTCTCTTCAATGTCAAAGTAGTAGTCGTGCAGGTTGCCCTTGCCAGGCATTGGAAGCGCCAGTACGTACGTGTTTTTGCTGTCTTCAAACGCAGGCTTCT
CCCACTTGCGAACCTGAAGTGCACGGCTTACAACAATATACTTACTCTCCAGTGCTTGAATATTCTCCATAATTGAGCGAACGAACTCACAAAACCTGAT
TCGTCCTTCAGAATTAATGCTCTCACCAACAGACCACGTGAGTGAGAACATGAAGAGCGCTTCGATCATCGCCTTTTTCTTGGACGCTGCATCTTTTGGA
AGCTTGCACAATTGTGCCTCAAAGATGTGAATGAGGCTTTGCACAAGGTTCGTATCCACGGTCGGAGACAGCTCAACTAACTCCTTCCTAACAAAAGCAA
TGCATGGTTCGACGAGCCATGAAAACAGGAAGTAGATGAGGCTCCGCTGGTCATTGTTGATTTCAAACGGGCCCAAAGGAGGTTCCTTGGTACCTTCCAC
CAAGGTGATAGAGTCCAGCCATGAATTGAGGACTGGAATCCAGCCCAGTTGCTCAGGCTCCATGTAAATCATGCCACAGCGAGACACTGTCGCAGGTGAC
GCAACCAACAAGTCCATGGGTTCAAACATCATGCTCATGACCGAACTCATGGCAATAATTTCCCCGCTCATCAAACACAATTTGCGGTTATCATCAAGCA
CAGTATTCATGTTTTCAATCCATACAGCATCCACCGGTCCATCAAACATTAGCCACTTGCGATCTGGTGAGGGATTATTAGCCAGATTTCTGTAGTTAAT
GGCAAGCACTCCATCATTCCATTCGTGAGAAACGGCATCGAATTGTCCATAGAGCTGCCCCATCGTTACCGACTTGGGGTTGATCACTGACACGATAACA
TTGGTATACCGTTGATCGTTAGGAAACTGCTGATGCAGATGAGCTAACACTTCAGACAGCACTCTCCACGAGCACGTTTTCCCTGAGAATGGCATTCCCA
CCACCATGAACCCGTGTCGCACAATCATCATTTCGTAGATTTTGAATCACCTTCTCGACAAAGTTGGGAACTGGTTGTAGATTCATTTGTTTGCATATAT
GGTCGATCGAGCTCAGCATGTCTCTCCGATCTGGTGGATCGATCGTCACGCCAGGGAAAAGATCCGATACAATACCATTAAATAGAGGTACATCGGGGGA
CAAGAACTTCGGCAAATTGACGTCAATGATCGATCGCAACACTAGAGTATCTTCTCGCAGATGTCCTTCGGCTCGTTTCAGGTTACCAGCAGCTCTAAGC
ACAGCCATGACAGCTCGCATCCCGTAGTCGTAGTGAGATTGAGATGACAGCTGTTCGGAGCACAATGTGTAGGTCGTCGTAATCTTCTTGGAGAGAGCGC
TTGCATCCATGTATCCGTAGGAGTACAACATTATCTCTGCAATCATAGCATAGTCCGGAACCATCATCGCTACAGTGCGGAACAACACCTTCAAGTTGTC
GGGTAGCTCTGCTCGGCCAGCATATCCGGGGTTCATCGTGATGAATGGACAGCAAGTAGGGTTTAGTCGGAGTTCTGTGCCCTCAAAAATGAAATTTGCA
AGGTTTTGAGCTTTCGCCAGCTGAATACAAAGAATTTGTTGGGCAATCACCGACAACACCTCCAGCTGAATACGATTAAATTCGTCGAAGCACGCCCAAG
CACCCGAGCTCGCAAGACCCTTGAAGAATTTTCCCATTGCGAGATAATCAAGACCATCAGAACAGTTTGTGACGACACATTGAATGGCAATAGCCTTTGC
AAGATCTTTCGTCGTCTCTGTCTTGCCTGTTCCAGCAGGACCCTCCGGTGCACCACCAAGGTTGAGGTGAATCGCCCCCGTCAATGTCCGGTAGCACCTA
TCCGTCAATGGGGTGATCACCAAACGCATACTGTTTCCAAGATACTCGAATGCATACAGGGCCAGTGTGTTAATCATTCGACACTCAAGAGTATGAGGCT
TACCTGTTGTCGCCGAGACCCCACCCTGGATCCAATAGTATCGCAGTTGAGCAAGCCAGTCGAAATCCGTTTTATCCGTGATTTTCAGATCGACCAGCTC
GGCAATCGTATCGCGGTTGTGTACATCCATCACCACAAGCGC