Description :
From Genome Similarity Track
Location :
Scaffold_1477:4987- 7063
Transcript NameFunction/comments
Phyag_g10742kinesin heavy chain, putative

Sequence
2076 bases(100 bases per row)
TTCAGGTCCAAGACACGTACGTGTCGAGTGCGGACATAAGACTGGATCTTGAGGTCTTGGCGGTTCTTTAGCAATGGAACGATTAATCGCCTCATATCCC
GGTTGATCTCTTCGCTTAGACCTTCAATGGATAGCTCGGGGTGGAAGTTCGAGCGGATATCTCGGCCTTCCAGTACAAACCCCAACCATTTTGATATTTT
CTCTCGACCTTGTTCGGGCAGGTTTTGAATCAAGCGTTTAATGACCTCAGACTCCATGCTGATCGGTGCAACTGGAAACACCTCACTATCCAGCTCCCAG
TCACTGTGTGACGCCTCTGATCCACGGCTGTCTTGACGTTGAATACCAGCCTTTGCCTCCGAATTTGATCGTTCAGACAACCGAGTGTGCTGACTACCAC
CACGAACAGACCGCAGCATCCGCGAATCCAAGCGAGGTCTTCGACTTCCAAGTCCGCGGACGCGGACATCATACTCATCCAGTTTTTCTTGTAACTCTTC
GATTTGGGAATCGTATTCGCTGCGACAGCTCGTCAACTCCGTTGTAAGTTCATCAACACGCTGCGTGCAAATTTTCAGCTCAAGAGTCTTAGCAGCTAGC
TGCTGGCGGAGAAGCTCATTTTCCAAAACCGAGCTACTAGCGCGCGATCTGTCCGTCGCCAAAACCAAGGATGATGCGggaacttcaacttggcccaGCT
TTTCAGAGTTCATTTCACTGTCTTCTTCAATTGTGGTCGTAGTGGCTAACGATGGCGTCTCGACCGTGGTAGCCTCGTTTCGTCGCCTCGCTAGCATTTG
CTTCAACTCTTCACATTCCTTCACCTTAGCCTCCAGTTCGGTTTCCAGATAAGTCAGTTTCTTCTCAAAGTCATGGCTCCGGCTAACGATCGAAGAGACC
TCGCGCTCTTTGTCCTCCAGATCCTTGTTTTTCGCTTCTAATTCGACACACCGATCTTCCAGACTTGagatttctgctgctttaGAAACCTGATCGTctt
cgagctcctccactttTGACGCAAAATTTTTCAGCTGCTCTTCCGCCGCAGTCTTGGTCTGATCACTCACATCGTTGTCTTTGGCTTCACGAAGAAGTGC
CTCGAGACTGGCAATCCGTTTATCCTTCTCAGCGACTAAAATCTTGAACTCTGCCACAGTTCTTTCTTCGTTAACCTTCGGCTTGTTCTTGATATTCTTT
GCACGTGTACCAAAGCGCAACGTAGACATCGTCTCCTCACTGTTATAGCTGCTGGAACTAGCACAAACAAGAAGAGTTGTCTCCGAATTTCCTCCAAGCG
AGTCTTGCAGTAACCGCGTCAATTTCGAGTCACGGTACGGAATGTGCGTGCTGGCATTTCCACTCGTCAGCGCATTCATGACACTGCCCAGGGCACTAAG
TGACTTGTTAATATGCTGCGCCTCCTTGAGCGTTTGTCCCTTAGCATGAGTCTTCCCCACTTTCTCTGATCCAGCCAAGTCCACTAGGAACAACTTTCCA
CTCTTCAACGACCCTGTAGCTGTGTTCCTTTGCTCAATTGTTATGATAAACACAGAATGGCTTCGACTGGATTCGTTGTTCATCCTCGTTGATGAAATAA
CTCGATTCGCTCCTCCCAAGCGCATCACCgactgcatctcctccactgaCGCGCAACAAACTTCCGTCGCCCCAGCAATCCACACCCCACGGTCTCGACT
CTCTCTTACGTTTAAATTTGTTGACGATGGTTTGAGCAGGTCGCGGATCTTTTCCATGTAAATCTCAATGTACGAGACTCGTACGATGAACTCGAGGTCT
GTCTGCATGTTCTGGATACCATCGAAGATGTCAGCCATGACGCGGGGGATAATGCCTTCGTACTCATTGTCTCCTGGCACTCCTTCCATCGAGAAGGTCT
TGCCCGACCCTGTCTGGCCATACACGAAGCACGTGCAATTGTAGCCACGTAGTGCGGACTCTACCAGTGGCTTGGCTGTTGCTTCGTATACCCCCGACTG
CGAGGAGTTGGGGCCGAAGACCtgatcgaaggtgaaggtgTGGTCGTCGGTCACGCCGCGTGCCTCGCTGTGCACG