Description :
From Genome Similarity Track
Location :
Scaffold_141:49869- 54962
Transcript NameFunction/comments
Hyaar_Emoy2810922GF16615
Hyaar_Emoy2810923delta-1-pyrroline-5-carboxylate synthetase, putative

Sequence
5093 bases(100 bases per row)
TGTATGCCAGCTTTTGAATCGGAAAGAAACTGTCGTGAACCCTGTCCGTCTCATCAATCTTGTCTTTGACAAGCTGCTCCAGCTCAGACGTGAGCTCGAG
CGTCGTTGCAATCTGAAACTCGGACGTCTTGTCAATGTACTTGAGCCAGATCTTGTGGGCCTGCTCACGTCGTTTACTCTCATTCACCGTCTGTAGCTGT
TCAATTTCCATGAGAAAAAGCAAAACCTGATGATAACTGCCGCGCCTTTCGACATGATTCGAAACTTCTGCGTCTACCAAGAGCCATTGCAGCAAATATG
GCAATTTCCTCGGGTCTTTGACAATCTCCTGCAGTGTGAACGGCACGTGGTCCTGGAACTGCTGGAAACTATCGATCGAGCAAATACCTCGGAGCTGTTC
TTGTTGCTGCTTGTCCATTTGTTTCAGTCCCATTCCTCTTCCTGGTCGCTTCCACTGCATTTTCGAGGGGCGGAAAAGCCGCCGCAACTTTACACTCACG
GGCACCGTCGGCTTGGGAAGAGCGCTCCTGTCCGTCATTGAGTCTCGAAGACCTGCGTGGGATACAGGACTTGGACGTCCAGTACTGAACGGCGAGCGGC
TGCTCGGAACAGTGGACCCCTCGTCGCTTGACTTGTCGTCGCCAAAGAGCCACGACTCGAGAGTCATGTTCGTCTTGGACCGCATTCGTCAACAGACGCG
GGACGGGGTGCAGTCAGTTGCGCAACTTGCGAGCAACATACGCAACGATAAAAGGTGTGTGTGACCCACACTATTCTCGACTCGACGGTGACATGACGCA
CCGGGCGAAGGTGCTGGCGCTGTATAAGCGCGTGTTGACACTGCATCGACGCCAGTTGAAGCCGCACATGCGCGTGCTCGGAGACCAGTATGTTCGCGAT
GAATTCAAGCGGCACAAGAGCGCAGATTCCAAGTTTGTGCCGCTGTTTCTGCGCGAGTGGGAGCAGTACGCTGCTACTATGGACCAGAAGAAAAACAGCT
TTGGTCAGGAGCTGTCTATCGAGGACCAACAGCTACTGGATGGTGAGCAAAAGATGAAGTTGCGTTCACTGCAAGACGCGGCCAAGAAAGTGGGCGAAAC
AATCGCATGAGTGTTCAGTGACGCGCTCAATGCCATTTGTTGGCGGTGCTATGCTTATTGCTTGGAATCAAATACCTGTGGTCATGATCACGGCAAACTT
GAAGCGGGTCTGCTAGGTCAATACACTTGAAGCTCAATTTACGCACCCTTGGCGATAGGTTATGCGTGATCTATTTTACCCTATCGTACGCATGCACGTG
CAAGTCTACAGGTTCACACACGACAGATATATCGCAGTTGTACGGTGCCAGAGTGATCGTCTGTCCGCGTCTAAATACGCGACGACGCAACGTCCTTTTA
TCTAGATACTTTATTTCTAAGTCGTACTGTCTCTTGTGTAGAAACAAGAAAATCAACAAACGGTCAGTGCCGTGTCGCACTGTTTCTTGATCTTGAACTT
GAAGCTGATGCCGCCACGTCCTTGTCGCGTTTAAAAGTCGGCACTATTCAATATTCCTTGTCCAGCGTAAACCAACCGTAGTATCACCACCATCGCCATC
ACCACAACTTATCGTTTTAAACAATGACCACCTGTCCACTCGAGCGACGGGGGCTCGGCCGCGACTTGCGCCGAGCGCGTACGATTCTCATAAAAATAGG
CACTGAGATCGTACACTCGCCTCAAGGTCTCCTGGCCTTGGGACATATTGGAAACATCATAGAGCAGATCGCCACGCTGCACATGAGAGGGCACAACATC
ATTCTCGTGTCCAGTGGATCCGTGTCCATCGGCAAGATGGTCCTCCACCGCCAGTACCTGCTCTCTGGCTCCATGCAGTCGCACCTTGGGGGTCACGTAG
TCGACAATGCCAAGTTTGACGAGAAAGCGTGTGCAGCTGCAGGGCAGAGCGGGCTACAAAGTCTCTATGAAATGCTCTTTGGTCAGTATCACTTGGCTTG
TTCGCAGGTGCTGGCGTCGGACGCCGACTTCAGGGAGCCGCAGGTCCGAGCCAATTTGCAGCGCACAGTCCGTGCGTTGTTGGACGTGGGTATCATCCCT
GTGATCAATGAGAACGATGTCATTACTCGGCGCACGACGCCACTGATGGATGAGAACAAAATAGCTTGGGACAATGACTCGCTCGCAGCACTGTTTGCCC
AAGAACTGATGGTGGACTTGATGGTTGTGATCACGGACGTGGACGGAATCTTCACAGGCACGGAGGTGGCTCGACAGCTACTGTCAAGGTTCAGGCGCGG
CGACAAACAGGTCATTGCAACCGAGAGCCGTGTCGGAGCGGTCGGACAGATTGACAAGCTGCACTCTTGCATTCGTGCCGTCGATAGTGGCGCTGTCCAG
GCTGCGGTCATTGCCAAAGCCGAGGAAGGAGTGTTGCTGCGGATTGTAGACGGTCAGCAAGTTGGCACACTTTTCGTGGCGGAAGGGGAGCGTATTGGCG
ACGTTGACGTGGAAAAGCTGCATGTCGACCCTCTGTACTCGTGTATCGCTTCGCATAATCGGAGTTCGACAAGCAAGCTATAGGACCCACGTCTGACCTA
GGTTTTCTCGTGTAAATTCGAACAGCGTTCTGGTCACGTTAAATCCGGCACCGGTGTAGCTTATCTGATTGCCTTAAAGGACTGGGTTGGAGGAAACACG
TTGAGAAAGCAGTTGCAGTCGACGTGTTTCGGTGAAACATCATCTGCCGTATATGCAGTTGCGATCGACGTATTTCAGTGATATATCATCTGCCGTATGA
ACAATCAAACCACCACGTGAACAGCCTAGCCCGCCTTTTCAGCGCTCTCATACACATCGAGCAAACGCACGAAAGCGAAGCAAGTACCACAACGATCGAT
AGAATCTGCAGCAAAGGCACCTTACCAATCCGCCATAACTCGCACACAATCTCGAGTCGACGGTAGAACGCAAAGACTGCAGAAGTCATAGTGTAGGAGG
TGAGCCCGTATTATAATATTGACATAGGTAAATAGCTATTCGGATATTTCGGAATAAGATAGGAGAGCAAGCTCTGGAGCTCGCCCCTTGATATAAGTAA
TTCAGTTCTTAGAACTGAATCAAGTTGCATAACACTATACAACAGCAGTTAATAAAAAGGAGTATGATGCTGTAAATGTTCTGTATTGTTGTTAATTGTG
CTTGTCGAGGTGAATGTAAAATGCAAAGTGAATATATTTAGGTCCTTAGTTCGCAACTTCTTGTTGCTACTCTAAGCCGAATGGATTCTTCGACTATACA
ACAGTAATCGACACTACGCGCATTAATCGTTGTATAGTCGCGCATGAGTAATCTACTCTATACACATTACTCATCACATATTTGTACATGATTAATCCAC
ACTACTGGTATCACTCATGGGATAGGCGCACCGCTAATCGCCAGACTATACCTTTCGTTTGTCGCTCGCTGGACGAGGCGCATCTTCAACAACACTCCCA
CTCGACTCGGCAGCGACCTGAATACCCAGCCGTGTGCGCAAAGCGTCGAACTGCATGGCGACGTTGGCTTGGTCATGAGATCTGCGACCATGTCTTGCGT
GGGGCAGTACTCCAGGTCCACTTGACCGTCCTCAACCTTCTCGCGCACAAACTGGTAGCGGATGTCGATGTGCTTGGTGCGCTTGTAAAACTCCGGGTTC
TTGGCCAACTCTATCGCTCCTTGGCTGTCTTCAAATACCTTTATGGCGCCGTTTCCTGCTTCTTCACCAAGCTCGCGCATGAAGGCCTTAAGCCAAACTG
CTTCTTGAATAGCTTCCGATAAAGCCATATACTCTGCTTCAGTCGATGATAGAACGACAGTGCGCTGCTTCTTGCTGTGCCAGCTAATGCAACTGCCGTT
AAGCAGGAACACATATCCGCTTGTGCTGTGTCGAGTCTCGATGTCGCCAGCCCAATCGGTATCCGAGTAGCCGATCAGTTCGCCGTTGTCAGAGCCAAGG
TAACGGATGCTGTGTGTCGGAGTCGCTTGCAGGTACCTGAAGACTCGCTTGAGGAATTGCCAATGTGTCGGGCACGGATCGGCAGCAAACTGGCTTAGCA
TTCCTATAGCTGCTGCAAGGTCTGGACGAGTACCAACCATGAGGTGCATCACGGCTCCAACAGCATTGCGGTACGGCACACCCTTCATGGTTTCGTCGTG
AATGCATCCACCACCGCACATGTTTTTTGTTAGCTTGAGACCGGGGTCCTGCGGCGTCTTCACAGGCTTGCAGTCTTCCATTCCGAACTTGGTCAGGACC
GACTGCAGGAACTTGGTCTGCCGCATCGACACATCGCCCGACTTGTCATCACGCTCTAATTCCATGCCGAGGCAGTACTTTAGTATGCCGAGTCATCTCG
AAGCACTCACTTAGCGCTTGCTTGGTCGCCGACAGGAACTCAATGTCGTTGCATGCGAGGATTAGATAGTCGACGTAGAGCACCACGAACATCATAGCTA
AGCCGCCACGCTTAACGTACACGCAGTGATCCATTTTGCACTTGGTGAAGCCAATCTTGAGCATGAAGTCGTTAGTGGTCTGATTCCACATGCGAGGCGA
CTGCTTGAGACCGTATAGTGCGCGCTTGAGCTTGCAAACATGATTGCGATGGTTTGAGTCGACAAATCCCACAGGTTGTCTCATGTAAATCTCGTCCTCA
AGAAATCCGTTAAGGAACGCGTTCTTGACATCCATCTGATGCAGCACGAGCTTTTACTGTGCTGCAAAACTTAGGATTATCCGGATCGACGCGAACTTGG
CAACAGGAGCGAAAGTCTCCTCAAAATCGACGCCGTACTTCTGTAGGAAATCCTTCGCTACTAGGCGCGCCTTAAATCGCTCGATTTCACCACTTGGTTC
TCCTTGACCTTGAAACCCACTTGCTGCTGATGGCTTTGCGGCCGCGCGGTAATGGCACAAGTTCCCACGTCTCATTCTTCCTGATCGACTCGAACTCGGA
GTCGCATGCTTCTTTCCACTTGTCTGCGTTGTTGGATTCCATCGCTGATTCAAACGACATCGGCAAATCTCCCACAGAATACACAACGCGAGC