Description :
From Genome Similarity Track
Location :
Scaffold_1:4986311- 4994425
Sequence
8114 bases(100 bases per row)
GGACGGTGTCAGTGCGACTGGCTGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATATGGCCGTCAAGTTTGAAGACTTTGACAGCCTCAAACA
GCTCACTGTTCTCGACATGGATCCGTGCTATAGGATCCTAGGCATGCCCTGGCTGGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGT
GCCAGCCGCCCTGTGCAGTCCGATATTGCATTGGTGAATCATGTTCCCACCTCTGTCAGGACCCGGGGTGCCCTCAAGGGTTGTCAGGGTACCAAAGCAT
CCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTTCGAGGATGTTTTGATGGTAGCAGCGCCCAGAGGAGGCGCTGGCCAAGTGGGTAACTTAGG
TCCACAAGCGGCTAACTTAGCTCCGCCGACAGCTGCAGCTGTCAAGAACACCGGTATTAGCGTGCTCAAGGTGGGTAACAGAGTTCCGCACAGTCGCCCA
GACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGGGGCACCGACATCC
CCAGACGTGGGTAGCAAAGCTCCACATCACGGTCGCCGTCGACGACGACGCCGCCACAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCG
ACTCGGAGTCCAGAGCCCCGGCTCCTCCGACAAGGCCGGTGGAAGTGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATATGGTGT
CCGCTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGACAATGACTACGGAGTCTTTCCTGGCGAACCTCAAGGCTGGAGAGATTGCCGAG
ATGGTGCTCATGAGACCTGAGACCACGCGGGAGGAGCTGAACGTCTCCTCTGTCTTGGACGAGAACGTCCTGGAGGACCTCAACAAGAAGCGTCAGACGC
GCTTGGGTTCTGAGACCCTTAAGAACCCCAAGGATATGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAGCTGCC
ACCGGATTCAGGCGAACAGCATGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCCCGAGGCAATGGCATCTTCCGCGCGAATAGTGCGAGGTCGTT
GATGCCTTCTTCGCTGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCAAAGTCCCCGCACTCGACGCCAACTTTCTGCGTCTGGAAACCGAACGGAAAGT
GGCGTCTCGTTAACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAAATCCACGAAAGGATTGTTGTTAAACAACATGGCCGGAAGC
GTACTGTACAGTGCGCTGGCTTTGGTAGACGGATACTACCAGATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTGAGCACTCCAAGCGGCATGC
TTTGGGAGTGGCTCGTCATGCCACAGGCCTTGTCTAACCCCCCCCTCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCTATTACGTACCTT
CGTACGGACGTTCGTCCATAGCTGTGCCAAGGGAGGCAAGACGGCCAAGGAAGTGCATCGGGGGCACCTCCGCCGAGTGTTGGACGTTAAGCGAGCCAAC
AAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGTTGACCCAGACA
AAGGTCAATGCCATAGCAGCATGGCCAACGCCCCGATCCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGATCAACTACCTTCCCAAGTACAGCGCAGTGT
ACGCGGGCTTAGCTAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGTTGGCTTTGACAGCATCAAGGCCAG
TCTCCAAGAGGCCCCTGTCCCGGTCCTGCCGGACGAGACGAAGCCGTCTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTACATTGCTGCAG
GCCGACACGACTGAACATGAACGTGTCATCTCGTTCCAGTCCAGGCAGCTTAAAGCCGCCGAACGGAGCTACTCTGTCCACGACAAGGTTGCTCCTGGCA
ATTAGTATGCCCTTGTGAAGTTTCGTTTCCACCTTCTGGGCTCCCGGTCCTTCGTGATCTACACAGACCACGCATCCTCGAGGACGGCGACCAATTCGCC
TCGCCTCCCCCAAAGGATGGCGAGGTGGCTGTCCTCCTTCGCGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCGTAACGTGCTTGCGGACGTC
TCGGCGTCCTGACTACGAGTTGGCCCACATCACATGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCT
ATCGTCAATTTCCTCACGGCAGGAGCGAGCGCGAAGTCCGACTGGCCTTGGTCGCGACAGCGCTCACGGCTCCACCGATTTGAGTTGAAGGAAGGTTTCC
TCTATTATCGGGTGAAGCCCAATGAATCTCCACGAGTGGTCGTGTTCAACGACAAGGATCTGAAGCTCAATACCCTCGCGGAGGCGCACGACGCGCCCTC
CAGCGGTCACTTGAGCCGCGAGAAGACCTTCCTGTCGGTCTCCCAGGACTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATATGTGAAGACATGC
GAAACATGTCAGCGGGTCAAACCCGCAGGGCACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGTCTTCA
TCTTTGGGCTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTCCGGTTGATGTTGAAGCTCTC
CGTCTCTAGTTGATAGCAAGCTGCGAACAAGACTCGTTGGAATTCGGCAATCGCGTCAAGCGTGTCTGCGTCAAAGATGGACAGGTCTTGGAGAGGGACA
ACGTCCTCTGGTTTGTATCCACTCAATCGATTGGCAATCATGTGGTTATATCTACTTGTGTTGAAGATGTAGTTGAATTCTTTGTTGTGGTGCTTAGGTT
CCAAGTTCCGCGATCAAAGATCGAGCGCGCAGTCATCTTCTCGCACCCGTTGGACGTGAGAGCAGCTGACACACCGGCGACAGGGGCGACGCGATCAAGC
ACACGGTTGACATGTGCGTAGATTGTCGGGGCCGCAGCAGTACGAGGAGGAGGAGGAGCAGGCGTAGCAAGACCAGAGGTCGCCGGTGGTGCATTTAGGA
GTTCCACGAGCGCACGTCAGGTGATAGCGTGGTCGGCGTTTGCTGCACCTGGTCGGGAAGGTTCCCGATGAGAGCTGGGCACGGTGCTGCTTGTACGGAG
AGGGCGAGAGCAACAGCGAGGAAGGGGCACGTTGCGAAGTCGGCGTCGGTGAAGAGAGACAAGCCTTGTTCTTCCGACGTCTTCACATGGACCAAGCGAA
GGAAGAAGACACGGGCGGCATCTATAGATATGTTCCGCTTCTTGATCATCGACAGGTCCGAAGATCACCCGAACAGGTACCAGAGCAGACACAGAAGAGC
AGCAGCTTGGTAGTCACTCTCAGAACATGCATTGACATACAAATACACAACCATTTGTTTTCAAGTCAGCCTTTGTACATGGTGGAGCCTTTGCTACGAA
GCCACCACCATCCCTTTTCAGACAAGAGTTTTTACCATTTTAAGCAGCCGCGATTCTAGCGAAGCTCGGTGCTGAGGAACTTGCTCTAGAAGCCGGATTT
TGGCTAGGCGATAGTACTGCATTGCAGTGTTTCGGGCCAGCAATTTACCCTTCTTTCCTTCACTAAACGCAAGATACATTCCAAACTTATCCATGACGCA
CACAAAGCTCTTGCCACTCTCATCCTTCTCAATACATTTCTTCACGTATTTCTCCTCAACATCCTCACCCTTTAAAAAATTGGAAAATGCTGCGATAGCA
GTTGTCTTAGCCCGCAATGTATTGCCAGGTTGCAATTCCTCCAAACCCATCGCGAAGGTCCGATAAAGCGGAATATGAAAGTGATACGTCTACCACTTGA
CAACTGAATGAACATACACATATTTTTGAGTTTTATCGGACTTGATACGTCCGATCGGGTGGCTTGGATGACTGACCTAGACCTACTATATCCGATTGGT
TAAAATCATGATTTGGATTAACTATGATTGGCTGGTGATATTTGCTGGCCGGTAATTGGCAGTAGATGCCATACAAAAGTCAAATATGGTCCGATAAACT
ATCATATTCATCCATAACCGATAAAGTATCATTTCGCGACTTCCTTTTTCAAAAGTTAGCTTGTTCAACATCCCATGCAAGATCATCTAGAAACCGTTAG
CTGCTATATTAGACAGTAGCTCATCAGGTATTGCTGTGAACCACTGGGCTTTCCTGTCAGGGCATCCCGAAAACATCTATGCTGACAGGGAAGCAGCGTC
TTGGCTCTAAAGCGTAGGCCAGGATGTGCCTCCAAACGATCAGCAGCCAAAACAAAAATTGAACCTATTTCATACCGGTTATTTAGGTTTTAGTAAAAAC
CGCAGGGGGTCTATAGCTCACCGAAAACAAGTTCGTCGCAGGTACGTGCAGAGCGGTCGTGACCAGGACACGGTGAGCGCTGCCAACAAGTGCAGGGTGG
GCTTAATCGAGGAAACGGCGAGTGGTGGGAGCAAGTGTGGTGCGGGTGTAAGCTCAGAAGTGGTGCGCGCTGAGAACAAAGTCAGCGTGGTCGTGAGCCT
GAACAGGGCGGGTGCTGCGGAGACGTACAGCGAGAGCGCGGCACAGAACACGGCTAGCGGCAAGTGGGGTCGAAACTTAATTGGCACTCCGGGCAAGTGC
ACGGAGGTCGCGGTCACAGCGCCATTTGTGATCACGCTGGGCGCTGAGATCAAGTAGTGGGGGCGTAATTTAGAACACGCGATCGCTGATAGCGCTCAGC
CAAAATGGTTATGACAAGGGCGCAAATAAATGCTGCAGAGGCTATGGAGCATGATGGAGAGCGAGCGCTGACTCTAGTGCCACCAAATGAAAACAATGCT
GCAAATTTGACAGCCGATCTTGCAACACATGAGGTTATGGGGACATACATAGAACAAGTTGGAAGTATATTGTAGTGTTATACACGTACGGAGAATTTAG
CTACGAGCTACACAAATTTCCAGCGTCAGCAAGAGCATTAAGCTCATGCGTAGACTGAGGATTTGATAGCTGCTCAGGAGTCAGCACAAGTTGGTGTAGA
GCAACTCGCCAGCCATTAGCAGGCAAGTACACTTCGTTTTCAGCAAGAACTACAAGACACGCGGCTTACCCTGGAGTCACAGCTCAATATGCTGATGTGA
AGGCAATCCGAACACGCTAAGGCGCTCGAAGCCACAGTGGGTTAGCACATAGGTATTATTTGTCGTGATGTGCTGCGTGATGTTGGACTAGCAAACACAG
GCATCCACGAACGAGCAGCAGACGTGAAACGGATTTAAGCAGGTAAAAGTTGTTATAACCCCTCTGTTACCGCAAAATGAGCCCGTGAACCACTAATTTT
ACGTCATAACTTACGGCGTAGCTTTTACCAGCGCGTTTGTATGGTGCTGTATCTTCCACTTGCCTATCCAAAACGATTAGATGTATACGTTCTCAAAGGT
TTTGACACGCTACGTCGTATATCATACGACGTAAGGATGACCCAAACGACACGGACACCGACACTTACGACTTTGTAAGAGTGAACATAAAAATTAAAAC
GGGAAGACGCAAGCGAATGCACACATAGAGCAGGGCTTTTCGATGACTGACATGCTAAAAGAGGAACAGACACAGAGCATATGGTAAAGGACGTCACATT
TATGAAGCAATGAACACACTCATCGTCAGGGAGATAACTAAGGAGGGCCTCCAGCTGGGATTAGCTGTCCTCATCGTCTGGCGTTCCTTCGCATTCACGG
TTCGGCCTCCTCGTCAGCACCCTCATTGTCTTCGCGGAGAATCTCACGACGAGTCTTCTTGCGGACGCCGACGGTTTTGGGAGCGCGGCGCAGCACGACT
CGCTTGCCCAGGTGTGCTGGGATCCTGTCACCGCACGCGAAGTCCTCGTGCCACACTTGGAAGCAAGTCTTGTCGCCACCTCTGCGCGCCTTGCCACACA
GGTAGAACTTGGCGTCGCCGTTGGAGCAGTCCAGGCAGTAGTAGGTCGTCTGGAACGACTTTTTGAGCTCGCCTCGATACAGCGAGCACACCTTGCACGA
CCGCTGACGCCTCTTCTGGATGCCGCCCCTCACAGTCACCCAGTCGTTGAACTGCACGAGCGTGTGCCCGGAGAATGCAGGGCGCCGTCGCTTGCGTGCT
GCTGGCGACGGAGTGGGGGCTGCCATGAAGTCTTCGTCCTTGAGCTGTAGCAGCTGCTTGTGCAGCATGCTCAACCACTCGTATCGCTTCATGGGCGTCT
CGCCGGCGAGCCGACTGGCCTCTTTATGCGTGAGGTACGCGTTGACGAGCGCCAGGTCCAGTAGTCCGAGGAAAAGACTCTTATAATACTTCCGGAACCT
GAAGGAGAGCTGGATGGAGGAGGACTGGAGGCGGAGCTGGTCATGCACGTCGACTCCTCCCATCCAGCGCTGGTAATCCGTCACCAACTTCGGGCACTTG
AACATCGAAGTCCCGAGCCCCTTCAGGTTCCGCTGGATCCTGTCCTCTGCCATGGACACACCTGTCGCGAGGTAGTGGACCGGCTTCCGGTCCCACCAGA
GGCACGAAACCATGGTCGGCACTGCCGTCGATCTTGCGAACTTGAAGGATCCACGCTCGATGCGCCTTGGTCGCGTCTTATGCTCCGCTACGATGTCGCG
GTTAAAGCCCAGGCGGTTCGTCATGATCGTACCGATCACGTAGATTGACATAGAGAGAAGCTGGATGGCGAGGGCTACGGACGAATAAAAGCGGTCGATG
ACCACAACCCGGAAGCCACGATGCCCAGCTAGAACAGTGCTCAGGTTGCGGATGACTGCAACATCTTGGTCCCGTAGCGGTGAGGCTTGTTTGGCATGAA
CATCCTGGTCGTGTTGCGCCTGGATGTCGCCGGCAAGACACCTTCGTCAAACGAGATGATGTTCGGCGGCTTCCACGCGCTCAGGAACCGTTCCTGCAGT
ACATCAACAACGTCACGGATCTTCCACAGCTTGTCTTGACGGTTCGGGCTGTCATTGTTCGCGAAGTGTAGATCGCGCAGGATCGACGTGCAGCGGTTCC
GGCTCATGTACTTGCCGAACGCACCTGCACTTAAAGCACCATCGTCGGTCATTGCCCAGTGCTGCGAAAAGCGTCGGGTGGGGCTCAACATATGAGACAC
GAGAAGCCCAATAACGCACAAGATCTCGCGCGGTGAGTAGTCGTTCTCCCGACGAATACGGCGTCGAAGTTCACGAAGTGTACGCATGTTCTCCGTTCTG
GACGTCCGCGATCGTTCATAACGCGCTCGATGGTCCACCGTCTGCCTTTTCATCCGGTTCGTCTCTTTGGTGATCCGCATCCACAGGCGCTTCGGTAGGA
AATAAAACATCAATTCAAGAGGTGATTCTTTCTTCGAGCAAAGTTCTGGTGTTGGATGGGCGGTCTCCTGCACCAATCCGCGAAAGCAGGACCCATCGTC
CGCAAAAACTGTCGAAGGCGCGCTCCAGGCAAAGTTTCGCAGCGCTTCCTGGTCCATCTGCTCGATGGACAAGGTGCCACCCAGGGCCTCAATGAAAGCG
GCATCCATGTAGGGCGACTCCTCGTCGTCCGATACCTCGTCCTCGTCTGGATCAGGACGGACAGGCTCCACGTCGTCGTCGTCAGAAAACTGGCCGTAGT
CGGAGCCTGAACTCAGACTCTCGTACGCCTCTCTAAGATCTCCAGCCTTCATCAAGTTTACATCAGCTGGATCGCGTGGTACAACTGGTCCTCCAGCGTC
GTCACCCTCGCTGG