Description :
From Genome Similarity Track
Location :
Scaffold_30:49862- 51190
Transcript NameFunction/comments
Hyaar_Emoy2804591protein phosphatase 2C, putative

Sequence
1328 bases(100 bases per row)
AAAGAAATACAACGATCGCTGTGACATTGTCCTCGCTCCCCCTTGACAGAGCCTCGTGGACAAGAATTTGCGCGGCTTGAGACTGCTGCGAGACGGGTAA
CGAGCTCACCATGTCTACAGCTTCTTGGTCACTCAGAACGTCCCAGACACCGTCGCATCCCAGTACGAAGAACGGATAGTCACTCGCTGGCTCGAGCCTG
AGAAAGGTTTCAAGGATAAGTGTAACACGCGATAGTGAAACTCGAGTTGGTTATGAACAATCTTTACCGTGTCGCGCTGGTGTACGGTCGTGCCACCACA
AACTGCTTGAGATCCCAATCTCCAAAGCTCCTGCAAGCGACAGTGCCACGTTAGAATGTTGCATTACATCTGCATGAGTGTGAGCTAGAAACGCTTCTAC
CGGGAGACTGCTAACAATCCAGACACTCGATGGTGCACAATAAAGCCGCCTTGTTGAACAATCCGCTTTACTTCCGTCTGATCACTGGCCTTATGGTCCT
GGATACAGCAGGCGACTATCAGCTCGTAAGTTGACTACAAGCCCCGTTACACACTAGGAATGTTTTCCTACCTTCGAAAACCGAATTGCTTTTCCTTTGT
AGCTAACCACGGCGCGGCTACGAGTTACGACACACGTCAACACTACACCCTCCAGTTTATGATGCAAGTTGCTGTACCTATCGCCAACATTGGCGACATA
GAGCGTTTTGACACCACCATCCTCTAGAACCAATGCACTGACTGCTGTAGAGCCCACTGATCCCTGACAGCACTCCATGTCTGACATCAAGTAACCACTT
GCAACAAAGCACTCAGACCCTCTCACTCTCACCTCACGACCTTCTGACTGACATCAGTAGTGAAACAAGTATCACGTACCGTTCAAGTCGCTGCCCCACA
GTACTATCATCATCTTCCAGTTGCAATTCCGTTGCAATATTTTCATGTAGCACTCGTTGTAAATACGTCGAGACGGAACGACCTACAGCAGACACGAACA
TCTCTCTTAGTCGGAACCAATATCATTTCTACTTTTCGATTTGATCCAGACAAGTAAGCGTTGTATTGCAACGTATCCTAGTACCCCCGTGTCCATCATG
GATCGCAAAGTATCCGTTTTGTGGATTTTGTAAATATCCATCTACTATCCGAATCGTGTCTTCCATCGTCTTGCGATACTCGGCATTCTGCAGACAAAAT
TGTCAGTATACAACGCTACTAATGTCATTATTTCTCACTGCATCGATCTGCACAACAGGCAAAAGACCCCGTACCATTTCCTCACAAAAGCTGACGCATC
GGCAGCAACTATAGACGTCGCTCATTTT