Description :
From Genome Similarity Track
Location :
Scaffold_23:498421- 499600
Sequence
1179 bases(100 bases per row)
ACAACGTCACGACGCATGCCGAACACGTTCCAATACGTTGGCGGAAACATTTCTAGCCAAGTCCGTTGGAAGTAATCCCAAAACTTACGCCACTTTCTGC
GAGAGTAGGTCACATGCTTCGCCTCACAAACTTTTTTAATCTTGGCCTTGACCCACGCAATCCCTTGAACTTCGATTTTACTTGGGTCGATCACCGTCAA
AATGTCAAAGACATTTGGGGCCATTGCTAGCTTGGCTTCGTCTCTTGGTATCTGGTACTCCTTCAGCTTTCGGCGACACGCTTGTTTAAAATGAAACAAA
CATCCGATGATACGGATGTCGGGGAAGTATGCTCGTATTGCGCCGATGAGAGCGGCCTCGAAATCACACACGACTTCCTTAGGAGTCAACTTCCGACCGA
CGCAGTCCTCGATACAGCGCAACAGCTTGATACAATGCTCCTTCTGCATGGAGATGGCTACCGTGAAGATAGCAGCGATGTAAAGATCGATAGATGGATC
GTGGACCATAATTGTCACGCACTGTTTGCATCCAGCAGGAGCACACCGAAACGTGCCGTCAAGGACCACGACAGGTTCTCGATACGCAGCAGATTGCGCA
GCTCAGGATGAGCCCATGCCAAAACTCGATCAAAACCGACCGAGTCGTTTTGCGCCTTAATATCATCGTGCCACGAGTACTGGAACTGAAAAAAAATCCC
TGCATGGATTCTCTCACTTTTGACACAGGAGGGAGCTCAACAGATCGATTGCGGTTGCCACCGGTTTCTTTACCTCGAGCATACCTCACTCGATTTTCAA
CCGCGTTCTTGGATATCCCACAGACCGGAGGCCCCGACTGCATGTAGAATTTCTCCGTAACGTGCAGCCAGATATCCCGTTGGGTCATATTCGTTTAAAC
AGCGAGCTGGTCGACCTCCTCTAGTACAGCCTCGCTCACATCTTCACAGGGGCTCCCATCAGCTTGAGCGTTCCTGCTTTGAAGTGCAGCGCCCGATCGA
CAGGTGTGGGGGACGAGTTCACTGAAGTCGAACGATACCGTTGCAGCCATGTACACAAATCGCGCCTTGCATTTCTGTCGATACGAGCTACAACGATACG
AGATCTTGACGCTCGTGATGTTCGACCGAGCGTACGAGAAACCCTGGTAGTACACCTTCGTATGCCCATCTCGCTTCTT