Description :
From Genome Similarity Track
Location :
Scaffold_553:4984- 8026
Sequence
3042 bases(100 bases per row)
CTATCTGCGAAGATTATAAAGTCTTCTAACTCTCCATGGGCCAGCCCAATCGCTATTATTGCGAAACAAAATGAGGTGGGCATCAGGCTTGCATCGACTA
TAGATTGGTGAATGAATTGACTTAACTTATGGTCTACCCCATGCCTCTAGATAATTAGCTATCGGAAGAATTGGACAAGGCTTAGGTTATTTCTCGCTAG
ACATGGCGAGTGGTTTTTGATATGTCGGTATAATTGAAAGGTCGAGACTAATTTCGGCGTTTATTACCCCACTGGGTTTGTTTGAATGGCTGCGGATGCC
GTTTGGGCTCAAGAACGCGCCCTATATATATCAGCGACTCCTGGATAACGCGTCATACGGGATTTTACGAATTCCTCCAGGAGTAGAGACAGATGGGTCG
AAGGATTTTTCAAGGTGGGAGAGCCAGATGAGGAGTCGGTTTCCTCGATCTTGGGTCAGAGGTCATATATAGATGACATTCTGATCCCCGCCGAATCCTG
GGACGTGCTTTGACAAAACTGAAACGGCTACTGGATGTGTGCGAATACTACAATTTGTCAATCACCAAGGTCAAGAGTTCGTAGGGATATCGGAAGGGCG
ACTACCTTGGGCATCGAGTATCTAGTGGAGGACTTGAGGCTTACTTGAAAGACCTCTAATCTCTGGTCGACCTACCCTTACCAATGACACTGAAGGCCAT
GCAATATTTTCTGAAAAGCTTGAATTACTGTAGCAGGTTTATGAAAGACTACGCCGTTTATGCATTTATTCTCTACGAATTGAGAGAGGTGGACTTTCAT
GCCCGACAAAACCAATTGAAGGGAGATAACAATGCCACTTTTCAGGATGAAAATGAAGAAAGGTGGACCCGTGTTCAAGTAGCCTTAGCCATGCTCAAGA
ATAAAATTGCCACAGAGCCAATTCTTGGACATTTCGACCCTATTTGAGAAGCTGTGATTATTGTATATGCAAGTAAATGAGCCATTTCGGCGTCACTAGT
GCAGGATTATGTAGGACTGCTTATACCGGTAAATTTAACAAGCAGAACCCTCAAGGCTAACGAATAAATTACAGTACAGTGGAGAAAGAAGTATTAGCAT
TATTGCGTATAATGGAGACCTGCTTCACTATGCTGGTCCCTCGCCCCCTCAAAGTCTTGACTAGACACTCGACATGTGCGTGGTTAATGAAATCTGCCGG
CTTGCAGGGGCACTTTGGAAAGTGGGCGGCTTTCTTGTCTCAGTGGACTTTGGAGATGTGAAGTGTAAAAAGGTGAAGACCAGGTACTGGTGGCGTTGGA
AGCCAGTATTAACCCTCGAAAGAGTGTCGACTCAATTGTGCCGTCCATTGCTCCTAAGAAGCAGGCGAGGCTGACGATCGACCTACCTACCCTTACCGTG
GAACCAGACGAAGAACTATGCGTAATGAGTTTCAATGGGTCAGCCCGTGTCAAGCAAGGAGGTGAGGCTTGTAGCGATATCGTATTAAGACTCCCAGCTT
GGACCATATTCGAAGCCGCCTCGAAATATCTCGATTCATCCACGATAAATGAGGCAGCATATGAGGGTACGCTGCTGGGATTTGACTTGTTGAAACCGTT
GGAACGACGGCGGTTGATTATCTGGAGAGACTACACTTTAGAAGTGCGGCAGATGCGGGGGAAGATTTGGTGTAAGGCCTCGGGTGTATTACCGCAACGA
GCCCGGAACTTAAATGACCTCCAATCGGGGCCTTCTCACGAAATCCTGCATGTGAAACAAGGTTGGAATCAGAGCGCGGATCAGTTGGCTAGTGCAGCCT
TGCACCAGAAAGGGGGATCAAGTCGATGCCGAGTGAAGAAAGACTAGGCTTGGAAGCGATCAATAGTCTACCGGAGATGCTTGTTATCTGAAGACCAGAA
CCTCTATACCAAAATATTTGCGGTGATTCGGTCGCGGTCTCCTGTTAAGATATCCGGAGAGACCATACAAGAGGAGGTAGTACAACGACTCCGCATCGAC
CGAATTCGAAAGGCGCAAGAAAAGGAGAGCTGGGTACGAGATTTAAAAAATGCATACTTAAGGGCGGACTGGAGTGACCTGTCGGTGGAATCCGCTAAAA
CGTGTAGCAAAATGTACGGAGATTACGATGTAAGCGAGGAAGGATATTTGGTTTATTGTCCAAACTACAGAGTCGAGGGAGAAGGCCGTAACATGAAGGC
CAGACTGGTGATACCTCAAAGTCTCCAGACCGACTTTCTCCACCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTCCGTTTCGGGGAGTG