Description :
From Genome Similarity Track
Location :
Scaffold_1:49839- 85538
Transcript NameFunction/comments
Phyag_g11hypothetical protein
Phyag_g12hypothetical protein PHYSODRAFT_321807
Phyag_g13myosin-like protein
Phyag_g14myosin-like protein
Phyag_g15hypothetical protein
Phyag_g16phospholipid-transporting ATPase, putative
Phyag_g17hypothetical protein
Phyag_g18hypothetical protein
Phyag_g1960S ribosomal protein L6, putative
Phyag_g20copper-transporting ATPase, putative
Phyag_g21hypothetical protein
Phyag_g22hypothetical protein PHYSODRAFT_426731

Sequence
35699 bases(100 bases per row)
ATCGCTGTGAAAATCCGCCcaacgctgctgcatttccTTGTGTGTGGCCGTCTTTGGGTGCGTTGTCCGTGCACAATGGGTACTACTAATCCGTTCCAAG
TGTCTAAACCAATACTGTCATCACTCTTTCTTTCAGTGCGTGATCAGGTCCAAGGTGCCAATCGCAGACGTCGCTGACTACGGTACCGATCatgaaggtg
gcgaagcTCGGCACAAGCTCCTGGTCTCCACTACTGATGGGGACGTGTGGGTGGTCACTCTACCAGGACATTTCCGACCTGGAGCAGGTGTGGTGACGAG
agaattgctgctggaacgctCGACAAGTAATAGCGAAGGTGGTTTCGTGCAGTGGTTCTGTCAGCTTCCTGGAGTGCAGTCGGTTCGATGTGCCCCAGTA
GGGTCAGGATTGACGTCTCTTACGCTGATGGGGAGCGTAGTGACGCCGTCGACATTGATCGTGAGCACTCGTGGGAGCTCCAAGTCTAAATTGCAACGAC
ACCAGTCGCTGGAGTTGGACGAGATTGAAGGTGAACAGTCGACGTGTACTTTGTGCCTGAATAGTCAGGAGATGAGGTATCGTGGGTTGCTGCAGAGTTT
GTTTCCGGAGGTAGTGAATTATTCGGCCGTAGCTGCGATTCTACAGGGGGATTTGGACGGTCAGGTGCGATTTTGTTTGGTTCGGTATCCTAGTGCGAAA
GGGGACGCCGCGAAGGCGTCTGTAATTCGTAGCGGTACACTTCTTCGGCTGGATGAACCTGTTCAGATGATCATCCCGTTCATGTCTTTCGTGCCGCCTA
CGCCATTGCTGGAAGGGGACCAAATATCGACATCGGGCTTTGATGCACTGCTCGTTCTTGGCACTCGAGGGAAAATGGGGATTGTTGAGTTGAAGGATGG
ATATTCTGCAGATAACCTTCCTGTTTCATTCACGCAGCTGGGACTTGGCCGTGTAGTGCAGTCATTGCTATTTGTGAACAGTGTGGCAGCATTCGTGTTT
TGCTCGGAAGGTTCAGCTTTCGTGTTTCGAAGCGCTGATCTACTTGCGAAGGcccaagctgcagagcgaAAAGGAAACAACGCCTCAAGCGATGGTTGCA
TGATTTGTGCAGAGAAACTACCTGTCCAGCCGGTACGTCTTTTAACAAGCTTCAGATTTTGCTGTATGGAATTGGACCGTGCTAACGAGAGGTTTGGTGT
TACACTAGGGAATCGTGCGTTTGATAATTGACGCCAATACCCAAGGTATATTAATTCTCTTCGCATCAGGGCGGCTCGCAGCTATCGATGAGGCAGCTTT
TCGCACGATGGTGACCAGTGTGCTACCGCTGCCGAAGCAATCTGGGAACCAAAATTGTCAAGGAATATCGTCAAAAACGACGAGCGAGTCTCGAGTTCGT
AATCTCTTGCATCGCATCGCACAAATTTCCACAGAATCGACTGCGTTGCGCGCCCAATCGAAGCAAATGGACCACCAGCTCAAGACTCTACACTCGGCTT
TGGAAATGCTTCAAGCAGTCGAATCAGCAGGCTAGATTGGTTGTGATTGGTATATCGTCGGTGTGCGGTCGTTTCTCACTTTTTTCGGTGGTGCTTTTGC
AGGAGTGGAGTCTGTAATCAAGTGCGAGTTGAAAGCTTCGATGGTAATAACGGGTACCTTCTCTGACCGACAGACAATTAGGTTGGAGTGCTCCTTACGT
TTCACGAATCCGGACACTATCGTCTCGTTCGACGATTGGTAAGTTATTCATTCGTTGATCGTACTACAAAATTTCATCGCGCATTCTGACGCGGCTCTAT
TCTGTTTTATCGTATAGGTTGTTGTGTCTGTACGTGCGTACTCGCGAGCTCGTGGTGACGACGTACTCGTTTCCTCTAAAGGATGTATCCACGGATGTGG
AGCTGAGTATCATCGTTGATCCAGACACACTCGCTCAGCAAGACCTGGGTTCTTTGTGGGTATCATGCTCGGTGTTATTTTGTTCCTCTGGAAGCAGGTG
CCCAGAAAGCGAGCATAAATTTGACTCGAAGGCAATTGATCAGGAGGACCCGTTGTCGTTTGCGATCCCTCTGCTTCAGGATCGGAAGTTTCTTCTCGCA
CAATTGAGTCGGcctgttgaagaagaaattccAGTCAGTCAAGTTGTCATTCAAGCTGCTTTCCGCCAAGATCACGAGCCATCCTTGCCAGTTGGTCGAG
CTAACGAAGAAGGAAAGGCCTCTTCGTCTGCACTATGGAGTGGGGTGCAGTGGTGGACTGCACTGGCTGATCATGCCCGTAAGAACCCGTCATTCGCAGC
TTTATGGTCAAAAATTGCGCCTCCAGATGCGACACCTTTGGAGTTGTCACCACCTTCGAGATTCGTGATATCTATCCCTTCATTCTTCTCcacagaagac
gacgatgaggatgacgaagacgaggatgaagattTTGAAAAGGTTCGCGTCGAGAAGATGGTGTCGTTTTTGCGTTTGCTCTTGGAGGTACCCATTGATG
AAGTCCCACGCCTGCGTCGTAGTTGCCGAACGCAGAATGGGAAGCTGTGGGCAGTGCTACGAGCTTTTTCTGGGAGTCTCATACTCCTACGTTTCACGCC
TTCAGAAGGCCAGCAACGATCAGTTGATATTGCGATTCAGTGCTCCGACGTGGCTGATCTCTCAGCGGTAGGTAATCTGCATTGGTATGTCATTAGCCTT
CCAAGATACCCTTCAGCTAACCATGGTGCTATGCAGATGCGATGTCTTGTGTTGGAGACGATCAACAACTGGAACGATAATGCCCCTTTAGGATTcagcg
aagaagatcgctCTGAAGAGTTAGCGCTCGATATGAGCGAGATGTTGAAGCCAATAGCAGCTCTTGAAGGTCTCGTGGAGGTTTGTAGCACATTGTTCTG
ACTCGGTGACACGAGTGTTGCAGTTATGATGACTATGTGTGCTCGTTGGCCTTCTTTACAGGATCTGACGTTGAAGACAGCCAAAATTATTGAAGACCCC
AAGTCGGCTAGTTGTACCGATGAAGTTCTTCACGCTCTCGCACAACTGGCGCACCTAGAGAATCAAACACTGACGCTTTACTGGAAGACAAGgttgctgc
tcaacaaaACCATAATGTAAAACTGCGCAAGCAAACTAGAACGAAATGTTTATAAACGCCGATGTAAAAAATGCAAACAAAAGTGGCTATCACTAAGCAC
CTTGGTGAATGCTTCAGAGTTCTTCAGTGGGGAGATGCTGGTCACGTAATGACGCTTTCTCGGACGGTGAAGATACCGAGTAGAGGCGCTATACGCAGGT
CACAAAACAATTCAACACAAACTGTCAGCACAGCGATGCAAATGCTACTCTGCTGCTACCGTACCTCGAAGTAGCGGGGTGCACGGGTTGGCCACAATGT
ATAAATGAGGGTCAAATAGATAAAGCAGTGCACTGAGGTCGTCATAGCTGCAACAGTCTTCTCTCGCACCCACGGCGACAAAAAGGATGCGATGAGCACG
ATAATCGGCAAGGCTACGAAAAACACCGAGAACAGACAGCACATCTTAAACGGAGGTGAGCAACATGTTAACCAGACAATGTAGACACATGTCTGTACTT
ActcgcaagaagaagtgtCTCTTTGTCGAAGCTTTCTCGTAGGAGCGTGTCTCCAGAATGGCGTTAATGAACCACCCTAGCACGCACACTTGCAGCACAC
AGATACCAAGCCCCGGCCACGAATCGTAAATGTACAGCGTCGACGCTGGATCAAGCCAAACGAGATACCACATCGCCATGGACAGGTAAAGCGCGAGAAT
GGCCAGTATGACACACGAAAGCTTGACCTGgccatccagcgccacattGTTGATTGTCCATCCTTTCGCGATTAGCATGGCGAGCAACAGTGTGCCCACA
TTGACAAACACGTCGGTGATCTTGGCCGCAACCTTGAAGAATGGCACGCCCACCCCATTGAACTGGTACCTGCTGAAATGAACGAAGAGCAACGCGTTGC
ACAGGAAGAAAAatagcaccaccagcgtgaGAATCTTCATGATCGGATGGAATGACTCGCTTCTTCTCATGCCCCGCACTGCCACACTTtgcgccactgc
agcagctccccCGATAGCCGTCATAACTGCGTAGATCGTCGGCATTCCATGTTGTTGAACGGGCAGTTCACTGCCATCTGCCTGCGTCATGTGGACATTG
AACCACGACGCGAAGTAATATTTACGGAAATTGGACTCGGTGATCTCTGCGAACGAAGGTTTGTACGTGTCTCCTCCCGGGACGCAGCGCGCGAGCGCCA
CGTACCAGAATCTTGGCCGTAGATGTTCGTGAATGTCCACATTGAAGGTAAAGGGGGTCACGTGGTGGCTACTGGTGGCTGTAACGTTGAAGACGCTCTT
GGTGTGCTTCGGAGAGACCTTGCAGTAGCAGTCGCAGGAATTGTCGGTCATGACGTAATCCCAGaagagctcctcgtcgtcgtagatGGCAACTTGAAGC
CCGTTCACATACGTCTCAATCTCGCCGGTGATACGCTGATAGGGAACGTTTATATGTTAGGAAttggtaaaaaaaaaaaattgtgTTGTATCTCACCCCt
gcgacggcgtcgagtgTGGGCGtccaggagaagcagaacttgcCGATGTATTGGAATTGCCGCCCCACTGTGTAGCCCGTGTAGATGCTGCCTTGTGTTG
GGGACAAGAGCGCCACGAGGACGagcactagcagcagcatttcggCGATTTTCTATGGTTGGCAAAGAACTTCAATAAGGCTTCTGAATGTATCGTACTA
TCCGGGGTATTAATTTATACCAGTACCGGAAGAGGGAGCGGGAACTGTATTGACTTGCTGTGCTGGTTCAGGCTCAACAATGCTCGTGCATTGTCATCTA
GTATATGGGTTTTCCACCTATGAGGACGGAACTAAAGAATGTCAACGCTTTCTTCAGCGGATACTTTCTCGGCTCATGATTTCGGTACAGCGTCGGTCAG
TGTGGCGTGGAttcggcgctggtggctcAAGTGTTGCGGCCGCTGATAGCCACAACTtgtgacggtggtggtgatatCCTAAATGGCAAGTCGAGTTGCA
GATCCGAGGTGCAACTCGCTGTCGAGGTATGGTGCTGCCATGGTATATGCCTCCTCAAGCAGCCGACGATGAGCGTAACGGGCTTGCTGTTTGTAAGAGT
ACACACACACTCCCATGCCGCGATCCAGCGAACAATGGGTCCGTGGAGGCACCCAGGTACTCAGTATATCCCCATGAACCTGGCTTCAGTTACCGAAGTA
TTTAGCGACGGCGGCTCCGCTCAGCTTTCCCGGCATGTCCACCCCCATCCTGGTCGCCTTATCGTGGGTCCCGAACTCTTTCCCCACCAGCTGTATCGCT
TTGAGTAAAAGAgtttgggggggggggcggCTCCTATAGTCAAGTCGAGTCGATTTTGCACAGGAGTCAGTTTTCGACTTACAACGGCCCAGTACCAGCG
TCGGGTCGTGCGGAGAAGCAGTGCGGAAaatctccttcgtcgcgtGTTGGTTGGGCGTCCGTTCGGGTGCAGCATTGCCAAAGAAGCCAGCGACGCTATC
GCAGACTCGATCGAGCTCTAATACTACGGGAGGCGTCAGGTGTCGAgacttcctcttcgtcttaTCCGTCCGTCagtcccagcagcagcagactcttcga
cacagcagcagacactAACAGGCAGGTGCCATGACGGTGCGTCGcacggaggagctgcaggagtgGATCTGTAGCGTCACCGCCACGTCCAACGACCATG
GTGAGCACCTGTCGGTGATGCTGCGCGACGGCCAGTTGCTGTGTCTGCTGGCCAACGGCGTGGACCCCAAGGCCAATCTCAAGGTGAACAAGCTCAACAC
GGTCTTCCACTCGAAGGCCAACATCCGGCTCTTCCTCGAGTGGTGCAAACAACAGGGACTCAATGAGGGCGACATTTTCCAGCCCGACGACCTCTTGGAC
GCAGGTGCAGACTTTAGTAcagtgctggagacgctctCCATTCTCTTCGACAGGTTCGGCACGATTGGCTACACGGGGGAGTACGAGGAAGACCCCGTTT
CAGATGCAGAGTCCATGACGTCCACCGGCAGTTCGCAGGGCGCGTCGCCGGTCAAGAaaaccaacagcaacaacaaactCACAAACTTCATGAAAGGGGG
ATTCttgtcgaggaagaagaaacagtCGAGtaagaaggtggtggacaagtCCCCGGAAGGAACTCCGCCATCCACGCCTCCCCCAATGTCGCCGCAGGTG
GGAGGAGGGATGATGTCTCCGTCGGGATCGCCGCCTTCGCCGTTGGAGCCACCTCCGCAGAAGGACACGAGGAGCGACAGTGGAGGTGCAAATTCAAACC
GATTGAACGCGTTCCTGAGTCAAGTGCCGGCGTCACACGGATCGCCGTTGACGCACGCGGATCGTCCCTCGGGCCCACCCAAGAAGGCGAATTCCGTGAg
gaagccgccgccacccAAGGCAAAGCCGCAACCTACTGTAAGGAGACCGCCGTCGCCTAAACAGCCCCCTAAATCGGTGCCATCCGGTGGTGATGCCCGT
AACAAATTTGCGGCGTTCATGAAGTCCAATCCGACACCTGCTTCGGGCCCGTCCCAGGGGTCTGGTGGCTCCAAGCCTGCTTCCCCGCCGAAGTCGGAGC
CTGTACGAGATCGCGGTACGTCAAATGATCAATTCGCGCAGCGCAAGGCTGTCTTCACGCAAGGTAACAGCAGCCCGAAACCGgacgctcctgctccgtc
gAAGCCATCCGTTGACACGGGTAACAAGCTTAACAGcttcatgaagcagcaaccgTCCGCGTCGCCCGCTTCCTCATCGAAACCTCGCTCGCAGAGCAAG
CTGGCTGCTTTTCTGGCGCAGACGAACTCAATCCCCTCGATTGCGACGAACCCGTCTGCCGCGCCGTCAAAACCGACGTTGGCTTCGTTTAATCCGTCAA
AGAATGCACCGGCTGGCGGGCGATCAGCTCCGAAGCCTGCATTCAATGCACCTGCGCCGTCCTCTGGGCCAACGCCATTCAAGCCGCGCCACATGATTGA
ACGTTCCACAGGTCGCGGCAACTACATTCGTAAGCGTCAGACGTACTGGGTGCCGCCGAAGCGCCGCCGaagcaacttcagcttggagaagaagcgaaaG
GCTTTcatgaacgagcagcttgagATTAAGGAGGAGCAACTCCGTCAGCAGGCTGCAGgtgccaacaacaagcaaAACCTGATTGTGCCTGGTGTGCAAT
GCTACATTCCTGACAAGGAGGAAGTGTGGTTGCTGTCTGAGATCGTGGATTACAACGACCGCAAGAAAGAAGTGACCATCACGGCTTTCTTGGACTCGGG
TGATTCGGAGCAGCGTGTTGTGGATCTCAAGAAGCCAGAGGTCATTCGCGCAGTTGCTGGACCGACGGCTACCGAGGTGGAGTCACTTCCGGTTGCCATT
CTTCATGACAACCCGGAGGGCGTGGAGGACATGCGACTGCTTCGATACTTGAACGAGCCTTCGATTCTGTTCAACTTGAAACAGCGCTTTGTTGCCTCAA
AGCCTTACACATACACTAATGACATTGTGATCGCAGTCAACCCGTACAAGTGGATTGAGAACCTCTACGGTGACCACCTGCACGACCAATACCTGCGGAA
GGAGCGTGACTCGCTTCCTCCTCACGTGtactcgacgtcgacggcagcTTACAAGCACATGAAAACCAACGAGATGAATCAGAGTATCCTGGTGAGTGGC
GAGTCTGGTGCTGGTAAGACGGAAACAACGAAGATCGTGATGAACCACTTAGCCAGCGTGGCTGGTGGCCGCAAGGACAAGACCATTGCGAAGGTCATTG
ACGTGAACCCGCTTCTCGAGTCTTTCGGTAACGCCAAGACGACACGTAATGACAACAGTTCGCGTTTTGGTAAGTTTACGCAGCTGCAATTCGACGGTCG
TGGTAAGCTGATCGGTGCAAAGTGTGAGACCTACTTGCTGGAGAAATCTCGTGTGGTATCAATAGCTGAGGGTGAGCGCAACTACCACATTTTCTATCAG
CTTTTGGCTGGTCTGCCTAGTCGTGAGCGGAAGGAGTTTGGTTTGGACCCTGACTGCAAGTACCAGTACGCCGGCTCACTTGCGGAGATGCAGATTCCCG
GTCTTGACGACAGCAAATGGTTTGCTGGCACGCAAAAGTCGCTGTCCATCATTGGCCTCGATGCCGGTGCACAAAAGACGCTTTTCAAGATCCTGTCAgg
tgtgttgctgctgggtgaGGTGATGTTCGACAAGAGTGGTGAGAGCGGATCGCGCATTTCGAGTGGTTCTGCATTGTCACAAGTCGCCAAGATGTTCGGT
CTTCCCACGACGAGAATCGAGGAAGCATTGTGCAACCGCACGGTCATCACGCGCAATGATAGTGTGACGGTGCCGCTGGCTCCCATCGAAGCGGCGGAGA
ACCGTGATGCGTTGGCCAAGACCATTTACTCTAAGATGTTCGACTGGATGGTGGTGAAGATCAACGCTGCCATCAGTACGGATGAAAGCCGCATTAAGGG
CCAAATTGGTGTCCTGGATATCTTCGGTTTTGAGGATTTTGTTCACAACGGCTTTGAACAGTTCTGCATCAACTACGCGAATGaaaagttgcagcagaag
ttcACGACGGATGTGTTCAAGACTGTCGAGGACGAGTACATCCGCGAAGGCTTGCAGTGGGATCACATTCAATACCAGGACAACCAGGGCATCGTGGAGG
TGATCGAAGGGAAGATGGGCATTATTGCCCTGATGAACGACCATCTGCGTCAGCCGCGTGACACGGAAGAGGCTCTGGTCAACAAGATCCGCACGAACCA
TcagacgaagaagggtggcgacgtgaacgagagTATTGACTTCCCCAAGGTGAAGCGCACGCAGTTCATTATCAACCACTACGCCGGTTCTGTCACATAC
GAGACGGTGGGCTTCATGGAGAAGCACCGCGACACACTGCAGAAGGACCTGCTTGACTTGATCCAGCTGAGCAGTCTGTCGCTACTTCCGGAGCTCTTTG
AAGACAGCGAGGCGACGTCGGAGGGCAGCGGGCGTGGCAAGAAGCCCCCAAAGAGTCTTGGCACGCAGTTCAAGTCGTCATTGGCACAGCTGATGGACAA
CATCAAGACCACTAACACGCATTACGTGCGCTGTATCAAGCCGAACTCAAACAAGAGCCCCACAGAGTTCAACAAGCGGATGATTGTTGAGCAATTGCGT
TCGGCTGGTGTGATCGAAGCCATTCGTATTACTCGCTCAGGGTACCCGAGTCGTCTGACCCCGAAGGAACTCGCAACACGTTACGCCATCATGTTCCCCC
CGTCCATGCACAGCAAGGACGTTCGCCGCACATGTAGTGCTTTCATGACGTCAATCGGCCGAAAGTCTCCACTCGAGTATCAGATGGGTAAGACGCTGAT
CTACTTCAAGAACGGTGTgatggaagagctggaagctaTGAAGTCCGACTTCATGTACTACGAGGCGCGCACCATCCAGCGTATTGTACTGGGCTTCCtg
gagcgccgccgcctgcgcAACAAGATCCGTGCAGCCATCGTGCTGCAGTCCTACTCTCGCATGTCGCTCGATTTCAAGGAATATCACTTTCAACGCCGCG
CGATCATCAAGATTCAACGTGGCTGGAGGAGGTACAAGGAGGTCCCAGTTGAGCCCGTGTACGACGACCAGGAGTACAACGGCGGCGGTCAGTGGGtcga
cgatgtcgatgacCTGGACGACTCGGATACCGACGAGGGCTTTGGCGACGACCCAGCTTCCATGCGTGCAGGCCGCGGCAGGTCGGTCGCGGACCGCATG
GAGTCGTTCAAGGTGGCCCACTCGGGTCGCCGCGGCAGCGTGAAGCGCCTCAATGAGCTGTCGGCTCGTGCCAAGAGCTTCATGAAGCCGCGTAGCGGAA
GTGGCAGCACTTCGAGCTCTAGTGGCATTtcgctggaggacgagaactcgatgctgaagatcgAGAACCGCAACCTGAAGTACGATCTTGAACTGATGCG
CGAGCAATGCATCGAGCTGCAGGCCATCATCCTCGAGATCAACAAGAGCCGCAAGAGATAAAGGAGGTGATGGTGCAATGTACGTCCAGTGCAGCTCTAC
CCTCGCTGCGTTCTCGGCAAAATCTCAAGACTGGGCGCAGCAAGAGGACCAACAGTTTTTAAGTAAACGCCGCGCAATGGTGGCGTATATCTGTAGCGAA
AGACATGTCAATTTTCTCTTTCAACATGTGAAGACGTTGAGTAGTTTACCTGGCGTTCACCTTTGCATCGTAGCGGACAACATCGCTGTCATATTTGTAG
TACATTGGCGGGAGAGGACCATTGGCAAGGGTGTGGGGTAAGTACCATCGCAGCGGTGCTGTCCATCAGATGGATGGTGCTTCTCTTGCTGTGAGTCACA
GTCGACATGAAAGTCTTGTGTGGCTTCCGGCATCATCCCCATCGGAGCTTAGTGCTGCGCTTTGCCTGCTATAGGGCGGGAGCTCGAGTTTTTCGAAGCG
AGCTGTCAGCGGAGCGAGGCGACAGTGCCGATAAGTCGGCGTAGATGGCATTACTGATGCCCGACATCAATCTCCGTCGCGCCAAGCGCCACCTCGAGGT
TTGTTCCAttgagcttctgcacgtcCTCGATCGGGCCTTACATGACGGTTATTGTCCCGCGTAGCGCTACTGGAGGCAATTGCTTGGCGGAGACCGAGCA
GGAGAACGCTTGATATTTCGGTCCGTTGGCCAGGCCAAAGCTACTATCGAGAATGCGAAACCTGCtgaagtcgacgtcgctccaccacttcaaaATCTAG
ATCCCGACCCGGAAATGGAGAAGCCCACGGTAGCGGTTGTCGGTGACTGCAATCGGAAGCCCGATGCTCGACTTGATTGCCGATCCTTATCAGTGGCGAT
CAATGCGAGCAGCAACCAGGACCAGGAAGACACCGAGAAGAATGAGGCACATCGCGAACTGAATCAAGTCTCTATCATCTCGAGTGCTTCTGTCGGTAAG
GCAGAGTGCAGTGGACCGCAGACGGAACTGCAGGCTGGTGGGAGGGTAGTGGCGTCAAACGACAATTTGAAGCCGGGGTCGCAGCCAACTCCGTCGTCGA
CAAGCACTACTGGAACGTTGTCGACAGTGAGTTCTGTCGCTTCGGTGACGTTCGGTTGTGAAGGAAAGCCGTCACCACCACTATCCATTCGACAAGTGTC
TAACaacggccaagaaggcatGCTACCACCGACCCATACCTCTCGTGTTCAAGGTCAATCGTGGTGAACTACTGCGTGCCCTTTAAATCCATGCTTACAA
TTTTTGTGCTTTGTACAGGTCCTACGCTGGGCTCTATTCTGCAGCGGGTTCACCTCAATGACGGCAACGTGAGTGAGTTGGACTTCTCGACCCTCGCACA
GCGCAACAAGCAATTGGGATCTGAAGGGTGTGCTCTTGTGGCTCGCTCTCTATCAACCAACCACACCGTTCGAAAGCTCGTCATTCGAGACCATGCTATC
GGAGACGATGGTGCCATAGCTCTCTCCAAGATGCTGTGCAACAACACAACTCTGGAATATCTAGACCTGTACGGCAATGAAATCGGTGTTCGCGGAGCTG
AAGCATTGGCACAAGCACTGTATGGGCACGACTCATTGACACACTTGTGTCTTCGGAGCAACTTGATAACCGACCTCGGTGCTGAGGCTTTAGCTCAGGC
TATTCGCTGCAATTGTACACTCAAGTctgtggagctcgtccagaACCGAATCACGAAAGTTGGGGCCCTGGCTCTGCTGGATGCATTGGACGTCAACCTG
CATTTGGAGACGGTGAATTTGGAGTCAAACGATGTACCAGCGTTTGTAACGAGTCAACTTGCGGCAGCACTCGCTCGCAATCGAGCCGAATCGTTGATCC
TGGAGTCGCACgctgcggagaagaaggccgaAAAAATTGTGCGCAGGGCCAGTGGGATGGAGAcccaagacgaagacgaggatgGCAGCAGTGAACTGGT
GGATGAGGAGTGGGAAGATGACGACAGTGAAAGCGTGTCGAGTGGTTTTCTGACTTGTTCAGGCGTCACCGACATCCCCCTTAGCAGTAGTGGTCTGTGG
ATTTGAATGCTGTATTGATCCACGAATTTAATGAAGTAGAAACGAAAAGAGTGAAATCCCCTAAAGCAAAAGCATTCTCGTTTGCCAAGTCAGCAAAAGA
AGTTGGCAGTGATGGTAGCGTGATCGTCGACCGCTGGTTTCACTTCCACACTGTCAACCCGTAGTTGTTTTGGGGGCACTTCGACATGTAAGTAGGTCGG
TGATCCCCATAATGCACCACGGCTCGCCTCCTCGATTTGGCTGTTCAGTTCCCAGTCGACCTTGTCTACCGTTGGAAGAGCATCGTACagtccaagctgc
ttcagTGATTCGTCGTACCACTCGTTTTTCTCCGTTGGCTCCCTGCCGAGAGGAGAAAAAAATCCATATACACGGGGCCCCTGTTGTGCTTCAGGACGAC
ATCTTGCCGTGCTTGCGTCGTATCTTAGTGCTGCTCCTTTGGTTTTGCTGAGCAATGGCCCGTCGCTATCGGCGTCAGAAACTCGAACTGTAGCAACCTG
TGGGTACTTGGGTGAGGTGATCATGGGTGTTCCAGCTTGCAGACTTTGCCAACCTGTCGACGGAGGCGAGACGAAGTGATTTTCCAAACCTTTCGGTGTT
GGGTCCTTGTAAGCAGAGAAGGCTGCATCCATGCGTCCGAGCAGCTTTTCTTGAATTGGGTCGCTCCTCTCCGTCTCAGCATTGTAAGATGCAAACAACA
CTCTTGGGTCCGTGAAAATGTCATAATTGAACCGTGCGAGCTTTCGTGGCGGGTTACCTTTGTTAGGAGACGACTCGGTGGTCGTAATTGGTTTGACCGA
GATGAtgatcaagttgcagctcacTAGCACGGACACCACGTCGTACACTCGGCGGTGCACATCTCTATAAGAAGTCTCGTCCCACAACGGTGGCACCATA
AACTTCTTGGCTTCAGCGAGACGAGCGCTCATTCTGGACAGTGCAATGCCTACCTCGCAGTCCTGTTGGAACAACAAGCCGAGGAAGCAGACCGTCATAT
TCACCAAGCAAGGCCACTTTTTAGCTGTCGCCTGGTCTTCAAAAACTTGGATGAGAGCTCTGTCTTCTTCCACGGTGCTGCCCGAACTCAAGCCTCGAGT
CTGTCCAATATTGACCATCACTTGTGCCGCGTTGCGCTGCATCtctgcaaggtgctgcaccacTCCAGCCTTCCCATAGTACAGAAATCCGCCCTTGGTC
TGGCGGGTATCACCACAGCGAACTCGCTTGATCACTCCAATCCCTGCAGGCGCAAAACGTTTTCGTATCTTCGCTCTTAGCACCCACACTTAACCACAGA
CGCCATACCTTCAAGCACGTGCAGTACGTCGTAaatccttctcttcctcgacacTGCGCAGCGCTCATCAGGACAGAACCCTCCTCTCCACAAGTGCACA
AGTCGTACATACCCTTCATCTTGTAAATCTCACTGGACGGGACGAAGATCGGGAACACAGGACTCGACCCCTGTAGACCTTCGTGCTCCTGGAAAAACTG
CAACGTGGTGCGCGTTCTACGCAGTTCCACAGCTTTACATTAGCACTCCACACTCTGTCCCCAAGCAGTTGGCGTCGTACATTTCCCCCAGGCTCTTGGC
AGCCGCGAAGTGTTCCTGGATGTCGCGCCACGTTGTAGCTGGGAGCGCCGGACGCACTGGGGCTGGGCTGAtgcgacgagagcgaggcTGGCGTTTGCGT
CGCTGTATTGGCCGCTTGGGGGCGCCCTCCGCTTCGACGGTCACCACGGGGGCGACGACTTTCGCGGAGTTGAAGTGCAGTTTGCGGCGGTGTGTGCGCT
GGTTCTTCATCGACTTGCGTCTGAGGCGGCAAATTCGAAAGTGAGGAGGGCAGCTGGTGTCCGCAGTTGAAGTAACGCGCTCAATGGCTATTCGACCAGC
ACCAATGCATTCAAACAGTATTTACCCCTCCAAATAAGCACGATAAACTATTAGATGGAGCAATTTGGTGATGGTCGGATAGCCTCTTGtttgacaagtt
gaagctcaTGCTttagttgaagtggtggatATGCTTGAGGCATTGCAAGAAGATACGCTGGACGAGTCGTTTCTCCTCCTTACATCGCTTGCTCCATATT
TATCGACCGACGAAACCCCAGGCCGACCTGTTCTATTCAGAGGCGTGGACGGTTAGTGCGGTGCTTCATTCCGCTCCATCCAAACTCGGCACTCTCACCT
CCTTGATCCTCTGTCTTTCGCTGTGCGTGGCGGAGCGAGTGACCCATGGGTGAAGGAACGGCAGGACACGCCGGAGACTTCCGCGTGGTTCACCTAAATG
ATGCACACCGCAACACTGAGGCCGGTTattgcaacaacttcatcgtcacGTCCAAGTACACGATAGCGAGTTTCCTGCCCAAGTTCCTCTTTGAGAGCTT
CCGTAAACTCTCCAATCTCtacttcctcgtcatctgCATCCTGCAATGCATTCCGCAGATCAGTAATACTAACGGgacgccgtcgacgttgccGCCCTTG
ATCTTTATCATCACGGTTGATGCCGTCTTTGCCATCCTCGAAGATCATAAACGTCACCAGGCTGACAACATCGCCAATGCAAGTCCGACACTGGTCTTAG
ACCGCGAAACGAAGAATTTCAAGCAAATCACGTGGGCGGACGTCGTAGTGGGCGATATAGTTAAGGTGACAAACCGAGGTCTCGTGCCAGCAGACATGCT
CGTGCTAGCAGTTAGTGAGATCCCCAACCAACCCCCGTGCGGTATTTGCTACGTTGAAACCAAGTCTTTGGATGGAGAGACCAATATGAAAGTTCGTTCT
GCAATGGAGGGCACGTTGGCAGATATGGGTTCTGTCGACAACTTGCTCAAGATGAAAGGTGTTGTCCGTTGTGAGCATCCCAACAACGCCATCAACAGCT
TTCAAGGCGTAATGGAGCTTGAAGGCAAAGAGAAAGCGTCCATTCCGTACGAAAGCATTATTCTTCGTGGTTGTATTATTCGTAACACGGAATGGGTGCA
CGGCGTGGTCTTGAACACTGGCAAGGACACGAAAATTATGATGAGTAACTCGGCTCCACCGTCGAAAATGAGTTCGATGGATCGGTCTATCAACCAGTAC
ACTGTCGTGTTGCTGACGATTTTGGTCCTATTCAGCGCAGCTGGCGCAATAGGCGCAGTGATTTGGAAAGCAAACCACGATTCCGTGTGGTACTTGCAGC
TTGGTGTGTCCGACAACAGCGTATTCGTGGATTGGCTCATCATGTTGTTTTACTACCTGCTACTCATGTACCAGTTCGTTCCCATTTCCCTGGCTGTGTC
CATGAGCATGGTCAAGTATCTCCAAGCTCAATTTATTCAGTGGGATATCAACATTTACCACCCGGACACGGACACTCCGACACTGGTGCGTTCCATGTCA
CTCAATGAAGAGCTCGGGCAGATCTCGTATATATTTTCCGACAAAACAGGCACCTTGACATGCAACGTCATGGAGTTTCGGAAATGCTCGATCGGTGGAG
TTTCTTACGGCAACGGAACCACAGAGATCGGGTTGGCAGCTCTCAGGCGCGCTGGTAAACCTATCCCAGACATGACTGCCCAGTCCAAGGGCCCTAAAAT
TCCTTACGTGAACTTCGACGGCCCCGAATTATTCAATGACATGAAAGGGGACGCGGGCTCTGCTCAAAAGGGGCGGATCGATGCCTTCTTCACACACCTT
GCGGTATGCCATACCGTCATCCCAGAGCGTCACGAGAACTCCACTGAAATCACTCTATCGGCTTCATCACCCGATGAACAAGCTTTAGTTGCTGGTGCGG
GATTTTTCGGGTACGAGTTTGTGAACCGATCTCCTGGTATCGCGCACGTCAAAGTTCGTGGCACGGTTAAAAAAtacgagatgctggacgtgttAGAATT
CAACAGCACGCGAAAACGCATGAGTACAATTATTCGTCACCCCAATGGACGAATCTTCTTGTACTCCAAAGGTGCAGATGTAATCATCTATGGGCTTCTG
GCAAAGGACAAAGAAGATGAATCGATCTCTTCCCAGCTCCAGGAGATCACCCGACGACACATTGACCAGTACGCTGAAGATGGACTTCGTACGCTCACGA
TTGCAGTTCGTGAAATCGAGCCTTCGTATTACGATGAATGGGCGTTGCGCTTCCACGACGCGCAAAACAATCTGAACGAGAttgacaagcgcaagaagga
tCTGCCGAATGCGATAGATGAATGTATGAGTGAGATTGAGTGTGGattggagctgcttggagcCACTGCAATCGAGGATAAGCTACAATCCGGTGTTCCC
GACACGATCGCCAACTTGGCATGCGCAGGCATTAAGATCTGGGTTCTCACAGGCGACAAGGAGGAAACTGCGATCAATATCGGTTTTGCCTGCCAGCTTG
TTACGAACGACATGAAGCTTTTCATCATCAATGGGAAGAATGCGCCGACCCCAGAGATACTTGAGAGCACATTAAGGGACGAAATTGGAGCTCGCTGCGC
TGATGTCACCGTTTACCTGGCCTCCCCACCGAGCAAGAGAAGTGAGCTGCGGGACCTCGCTTTCGTTATCGATGGAGAGACGCTCATGTACGCTCTGCGT
GGAACATGTCGCCCACTTCTTGCCGAGTTTTCGCAGTACTGCAAAGCTGTTATCGCTTGCCGTGTATCTCCCGCTCAGAAAGCCGAGATGGTTGCCCTGA
TCAAAGAGTATGTCCCTGGCGTCCGAACGCTTGCAATTGGAGATGGAGCAAACGACGTTTCCATGATCCAAGAAGCTCACATTGGTGTTGGCATttctgg
ccaagaaggcatGCAAGCTGTGAACTCGAGTGACTACGCCATCGCCCAGTttcgcttcttgcagcgcttGTTGCTTGTTCACGGTCGATGGAACTACCGA
CGCATGGCACAACTTGTGTTGTACATTTTTTACAAGAACATCCTTTTTACCGCGGCACAGTACTGGTACACGCTGTTGTGTGGGTTTTCTGGGGAGAAGT
TTTTCCTTGAAAGCGGCACGCAGCTGTACAATATCGCTCTGACTGCGATTCCCATCGTCGCAGCGTCGATCTTGGATCAAGACGTCAATGATGATGTCGC
CATGACGTTTCCAAAGTTGTATTTCACAGGACCCCGCGATGAAGACATCAACACTCGCATTTTTTCCTTGTGGGTTGTCGGAGCGATTGTCGAGAGCCTC
ATCATCACGTTCATTACGATTCACAGCGTACAGGCAGCTGGGTATGGTGGAGGTAGTCCTTCAATGTGGCTGGCGGGCTTTATCGTCTTCACTCTCGTCG
TGACGGTAGCCAACGCAAAGTTGTTCATGTTCCAGAACAGCTTCTACTTCTTCAATTACTTCCTTTACTTGGGTTCTGTGTTCGTGTGGATCGTTGTCGC
AATGGTGTGCAGTCACGTCACACTCCTCGCTGATCTCACGTGGGAGCTCATGTTAGAGCAGGCGTTCGGTCTTCCATCTTTCTGGTTGATCTGCTTGTTT
GTCCCAGTAGCCGCCCTTTCGTACGCCCATCTTTTCAACGGCGTAAGATCGACTTTCTTTCCGGAGTATTGGCATCTTGCCAAGGAGGTCATCAAGTTTA
ATCTTGATCGCAAGCTTCTGCAGTGGAACGATAATAGCAACGCGTCGGTGGCAGTACCAGCTCGATTACCGCACGCAAAACGATCTGCCAAGAAGAGTAG
CTCAGTTATCCCAACTGACAGccgaatgcagcagcacagaaCCACGCTTCAGAAGGCATATCACGGGTTTGCCTTCTCCAAAGATGGTTACGCCGGGGCA
ACAGAAACTCGGCTGCTCATGAGTCGTAGCTCCATCACAAGTATTAATTAGACCCGTAGTTGAATCTTCATCAATGCACAAAATTATCAACCTCCCTCTC
GTTCGCTCGCGTAGAATGCCAATCGTCTTGATGGTGGAGTAGGCACTACATTACCGCTTTCTGCGTACCCGATATGAGACATAAACATTGGTGGTgagaa
gaacagcaactCGTCGACCACTCGATGCCTCCCCTCCAGTGCCGTGGCTGTGCCAGGTCCAAAGTCAGCAGCTCGACTGAAAAACAACCTGGCGGCAACT
CCTTCCAGTCGGATGTTCCTCACCAATTCCAAACTCCGTCCTTCTCGCCGCCGTACATACTTCCTCGAGTGTTGTAATTTAATCTTCTGGTATCTCTTCA
GGAAGCGGcgttcgtcctcttcatcgcaGGCAACGAGTTGGAATGCGAGGCGACGGGGACTCCAGCGACTCAACCGCGCAAATCCGCGCAGGTTCCTGGC
GAGACACAGTCGCTTCACTGCCGTGTAGATACACATGTCGTGCTCCCGTTGCGCTTTTCTTCGGGCGTCTTCCAGCCTCGCAGCTTCAGATATTTCCAGT
AGCGCGTCAGCATCCTTTGTCTCTTGGTAGACTTGTTGAGGTTGCGCTGCCGGTCGCTTGCCTCGCTTCTTGGGGGTCGCACGGCGCGTCACTAACCGCT
CGTATCTGTTGCATACAAACGACCCGTTAACACTCCGCCACGCACAACGCGCTGATGGCTACTTAGCAAACATACAGGCGGTTGAAGTCATCGGCGCCGT
CTCCTGCCATGAGAAAACAGAATGTTCAAGTTTGAACTTCCAAACTTGAATAATCGGTTATCGCTAAAGCGAAAATTCTGGGTAATCCAGGAGCCAAGAG
GATTGGCCAACGGAGTCAAGGCGTCCGCAAAGTGCGGACATTAAACACAAGATACAACTGTAAGTTCACAAGGTCCGTGTATTCTTCAAAATCCAATTTT
CACACGAGTCCAATCGTCTCTTCCCCACTATACTTGTCGAAAAGACGGCTCACCGTGCACGCCGCGAAACGTATGGCGCCCGCTATACGAGCCAAATGTT
GCACGGCGGGCGCGAAAAAACACAACACAGATTGATTGGGACGTCAAGGCAAGATGCTGCGCGTGTCCAACCTGCTGCGAGGCTTGACGGGGGCGCCGCT
ACGTCGTGGCTCCATCCTCAATCGCTCTTGTGTGCGCGCATTCAGTGTCCAAaatggtggcgatgaagacgacgaagatgacgaatacttggagctggac
tgggacgacatcgacgacgactttgGCGACGACTgggtgctggaggacgacggcgacgtggcctCTGCCGGACGCCGCAAGGTCGAGGAGCATGTCAAGC
AGAAAGTGAGTGTCCGTCGCGCGAAGCATTCGAAGCGCCGCTTCGTGGACCGCATCCGCGTGAAAGCCACCGGCGGCCACGGAGGCAACGGATGCGCCAG
TTTCTTCGCCGAGTCGGCGATCCGTAAACGCCCCAATGGCGGAcacggaggagctggaggtgacgtTGTGATTGAGGCCAGTGACAAGATGCAGAACTTG
GCAAACGCCACACACCACTTCAAAGGAGGAGCAGGCACCAACGGCATGCGTACGTGCAATGGAAGTTGCAGTGTTTTTGAGGACGATTTAGTGGTGTTGA
CATTGTTTTACTGGGTTTTGTGGCTGCAGCTAATGATTCTGCTGGTAGGAGAGGCAAACACTGCCATGTGAAGGTGCCGTGCGGTACGCTCGTCAAGCGT
GTGGAACGCTACGAGCGTGAGCTGGAAAATGGCGAGTGGGAGACCGTGGACCGGATGCAAGTCGTGGCCGATTTGGACAAACCTGGGGCTTCGTTCTTGG
CTGCGAAGGGTGGCAAGCCTGGATTGGGCAACCGTATTCTGGCGGGTAAGACGACCAAGTTTGGACGGCTGCGTAAACACATGCCCGAGAACAAGACGAC
CGGTTCGCCTGGTACATCGCAGTACTACGAGTTGGAACTCAAAACGATCGCTGATGTTGGACTTGTGGGATACCCCAATGCGGGCAAGTCAACGTTGCTG
AGTGTGCTGAGTCGCCCCACACCTGAAATCGCGCCGTATCCGTTTACGACGCTTCACCCGTACGTGGGTATTGTCGAGTTCCCGGACACGTACCGGTTGA
GTGTGGCTGACATCCCCGGGCTTATTGATGGCGCCCACCGCAATGTCGGTCTTGGCCATGACTTCCTGCGCCACATTGAGCGCACAAAGGTAAGCTGTTC
AAAGTTGAACGCTGTAAAGTACCGGGGATTTTATCTGATGTGCATGGTTTTCGCTAGATCTTGATGTACGTCCTGGATACGGCCGGCTCTGAGGGACGTG
ACCCTCTGGAGGACTTCAAGCATCTGCAACGAGAACTGGAATTATACGCTCCAGGAATCTCGTCACGCCCGTCTCTCATTGTTGCCAACAAGATGGATGA
GCAAGGTAAGGATTTAACGCTGCCCAGTTAATGAGTTGGCGCTAACGATTATTATCTGCAGGTTCTGAAGACAATTTTCACAAGTTGCGCAAATCTACGG
ATCTAGCTGTGCTTCCAGTCAGGTAGGCTCCAACATAACGCACTCGCCCCACCACAGTACTAATAACGCCTTCTCAATATGCATTATCAGCGCCCTCCAC
AAGGTTGACATTGATACCGTAGCACGCACGCTCCGCTGGATGATTGAGAGTTATGCCAAGCTTACCAAATCCTCGTAAAACGGGTGCGGTTGCCGCCTTG
GGCTTATGCTGTCAGCGCAATAGGAAAAGATGCTgccatcatcgccatcatgaCTTTGTGTGTACTTTGCTCGTGCTGCGATGGTTATTAATAAGGTTGC
GGTCGTGATTTCGTGCCAATTATGTTTTACTAGTACACCGCCCAAGGCTTGCAGCAATTCCGGTGCCAGCCAAGATGAATCGCTATGAAATGCTGGAGCG
AGTCGGTGATGGTGCTTTCGGCGAAGTTACGCGTGCCCGCAGTCTCAAGACTCACGAAATTgtggctgtgaagaagatcaaggcgGTGTTTCCCACTTGG
GAGGAATGTCTTCAGTTGCGTGAACTCAAGTCGCTGCGGGTACTTCGTCATGAAAATATTGTGCTTCTGAAAGAAGTCATTCGAGACAAGGAGGAACTCT
ACTTCGTGTTTGAGTACATGCAGACGTCACTTTTCCGCGTCATGCGGAACTTTAAAGCTGGATCAGGAGCTGAAACGAGTTCAAGTGCGGACGCGTCCAC
TACATCATGGACTTCAACACCTCCACATCCATGGTTTTCGGAGGTACAGATACGGTCGATCATGTTTCAGCTTTTCTGCGGTTTGGCGTACATGCACAAA
CACGGCTACTTCCACCGCGACATCAAGCCCGAGAATCTGTTGTGTAACGATGAAACACTTAAGATCGCTGACCTGGGTCAAGCTCGTGAGATCAGATCGC
GCCCACCGTTTACAGACTATGTTTCAACACGATGGTACCGAGCACCTGAGCTGTTACTTCGGTCGACGACGTACAACAGCCCGATCGATATGTGGGCTTG
CGGTTGTATCTTGGTTGAGCTGCTGATTTGTACGCCGCTGTTTCCTGGGACGTCGGAGGCAGATCAATTCTACCGCATCTGCAAGGTTCTTGGTACGCCC
ACCAACGAAACGTGGCCCGAGGGTGCAGCAACGGCCTCTCACATGCAGGCGCGCTTTCCTAAATGTGCTCCTGTATCGTGGAAGCGATTCCTGCCCCCAG
GTACACCACCAGCTACTGTTCAACTCGTGCGAGATTTACTGCAATATGACCCAAGCCGACGTATTACAGCGgcgcaagcgcttcaacacCACTTTTTTGA
TCAAGCCGTGACACGACCGACACTAACGATTCCTCCGTTGGTGATGCTAGAGCAAGAAGTGCCCGTGTTGCCACTTCGAAGTGAATACAAGTCTGTCGGA
GGGTATTCGAGTTACACAGGGCGACAAAGTGTCGGTGCGAAGAAGTTAGATGAGATTCAAGCCTCAGCAATGGAGACGTCGAGTCATTGGGCTGGAGGTG
GATTATCATCGCGACAAGAGCACCACTTGTGGACAGCCAAAGAGCGACAGCAAACGCACGTTCGCCATCAGGAATGGGGGTCTTCACTTGTTAGTGCTCG
CCTTGGAGGATACGATGAAACAGCAGACGTGAAAGCTGTGACATCAATTCAAAGTAATGGAGGTCCCTTCAAAGGAAGCTCAGTGAGGAaaagctccagc
ttcaacgcaCTTGTGAACGAAGATGGAGGTCTTTATTCCACGAGAAAATGCACGTCTGTGGACACCGGCGAAGACGACAAAAGCGATAACACGCTACTGC
AAGACCTACTCGATGAGATTCTAGGCTAAGACAACAAAAAATTTGGTGATAATTTCATCAGGTATATTGTTCTTCTCATCTCATTCCGTTGCACATCATG
CTGCTAGCAAGATAGCACTTAGAACTTGAGGGCGTGGGCGCGGTCGTTCTTGGTCAGCGAGAACTTGGCGTTCAGGTAGGCCTTGAGGAACGGCTCGgcg
tcgagcttcttgatcaGAGCCGAGTCCACGGCCTTCTGgtccttcttgcgctgctccGAGATGACGGGGGCCTGAGGTAAATAAACAGCAACACGGTCAG
TGTCTTATAGGGAGCTTATGTGCCGAAGCAAGCGATCCCAAGCGCTCAAGTGGTGCGGAAGGAAGCACGTATTTTGAGAAAATATCGATGCTTCCATCCA
GATCCGCCACGCAAGAAATGACCACCACAACAGAAGACAGAGAGAGATCCCAAATGGGTTCGTCGATCTCGTATCTTCAACAGGAGAGTCACTTCATTGC
CGGGTGTGGACGGATCATGTGAAGTGGTCTCGAAGAACCGACCAACCGGAACGGGGTGCTCGCAAGGGATATTAACAGCAGAACAGGAAAAGAAACTTAC
CGCGCTCGACTGGGCGAAGAACTGCTCctccttgctcttcttggcgaccttctccttggcgaagTAGGCGTCATCGATGGCGGGGAGAGCCACGCCCTCA
ATGTTCACCTTGGTCGACGTGGCGATCACGTACGACTGGTTCACGCGACGGAGCGGCACGCCGTTGACCTTGTAAGGGCCTGcaaaacaacagcaaaaat
aCACGACGTCAGCAACCAATGCTCACTGTATCTGCATCCCCCAATGGATAGACGATCGAGTCCAGCATTCCTCAGGTCTCATAATCTGATGGATCTTTGG
CAAAAAGTATCCCCTCCTCGCCCGTTCAATGCATCCAGCGCTAATCGCAATACTCGTACCGGCAGCAATCATAGCATACCTCGAAAGAGGTAGGCACAGA
CCACCGCCAAACACGAGACACGAGACGTGTCAACATAAACAGACTAGGATGGGACGGCAGTGCGCCTCTCGATGTGTCAAGTTTGCATCATTGGAATGCC
GGGAGTGCAGTTCGTATCCAGTAATAAAAAACTGGGTGAGTGTCTTACCagtgacgagcagcaggcccGAAGCCAGCTGGTtgaggaagacgacgcgctT
GCCACGGAAGCGGCCCGAGAGCAGGATGAGCACCGTGCCGGGGGTGATCGacttgcgcagcttggcggTCTTGACGCTGTTGCGCTTGGTCTTGGCCGAA
GGCAGCGGCTTCGGGATGTAGTCGGCCGGGTACCACTTCTTGGTGGACGGCTTCTTAGCAGcgaccttcttctcgccgccCTTCTTGACCATCTTGCCAC
ggccgttcttcttggagagGCTGTTGCGCGAGATGGCGTTGATGCCACGGGCGAGGACGACGTTCGCAGTCTTGGAAGCGGGCATGGTGATGAATATACC
TAGCAATCAATGGAAGGGGACAAGATTAGAGAGGCCTGGCCCAGAGCTACGACGTCATGACGATCGCAGCTTACCTGTCTGAAAAGAACTGAGCGAGTAT
CGGAGCTGTCGGTAATTTTCAGAGCCAACCACAGCCAACCACAAAATTTCGTGTGGCGACACACAACAatggtacagtgtaccgAATGTTCATGTAATCC
AAGCCATCATCCCGCAACATAACACTCAAATGGTAGCAACATAATATACTATGTTGCACTCTAATCAGATGAGCAACATGACCCAACAACGCGCGACTTT
CTCTCTTGAAGCGGCCTTGATCGCATCCTTCCTTCCGCGCGGTGCCGCGCTGGCCTCAGCTCAGTCTTCATTTCGACGTCTACCTACtaaggagaaggaa
gaggagaaagaaACGCATGGGCAAGCGCAAGAATCGCCGCGCGACGGCCGCAGCCACCGCTCTGTCCGATCCCGCGActgcagagcaagaagagaCGGTG
GATTCCTCCAGCGCTGGTGACTGCGGCGGCGTCAAGAGCGACGGAAACGAGACTGCAGTGTCATGCTCcagcggcgaagaagaaggcgacggaACAGACG
AGACGCAAGACGAGGAgagtgaagctgctgctgctgctggctcgGGCTGTTGCTCGTCGAAGGCTAAAGAGACGGCGGATGACTGTTGCTCctccaagaa
gcaggaggctAAGGGATGCAGCTCTACTGAAGCTGCTAAAGCGTCCAATGGGTCAGGCTGTTGCTCGTCAAAAACTGCAGAGATTGCAGACAAGGCGGAG
AAGGGCTGTGCTGCCAAGGAAACGCCCATTAAAGCGTCTGGTTGCTGCTCATCAACGGCTCCAGAGACTTCAGGCGACGGTGGCTacttctcgtccaaga
agtcgacgaaTAAGAACAAAGCTGAGGGAGGTTGTGAGCCCAAGAcatcgagttgctgctcgtcgaagGCTCTGGAGGTTGTTAGCGAGGCGGGTGGGTG
TTGCTCTAAGGAAAAGAAGACGTTAACTTCTGGTTGCTCCTCGAAGGGGTCCAATGTTGACGCTAAACGTGACGATTGCTGTGCTTCCAAGAAGGAGCCG
AAGAAATCTGGAGGCTGCTGttcgtccaagaagaaagagtCTGGTTCGGGATGTTGCTCGTCGAATGCACAGGAATTGCCGGGTCCAGAGCGATCAGCCA
GCTTTTTGAATCGTTTGATGCAGTTCCGCAATGACCGTGGGGCTACACTTGAGAACCATCGGTCAAGTCTAGACCGTTCgggaaagaagaagaaaaagac
aaCCGAGTTGGAGATCCTCCGCCTGAATATCGGTGGGATGAcgtgcagcggctgctgtaCTCGTATTGAAAAGTTCATGATCACGCAGCGTGGTGTTACG
GACGTGAACGTGAGTCTACTTACGAGTCGCGGTATCTTCCGATTTGACCCAAAAGTGGTGACGGCGAAACACATTGAGGAAACTGTGTCAACTATGGGTT
TTGAACCCAGTGTACTGTCCAGTGATGCGCTTGTAAGTATCGTGCTGCACCTTGGTCAGGCGAAGAGTATTCCACAAGCAAAACAATTGGCTCTCCAGAT
CGACGGTGTTGCAATGGCTGAACGAGTTGATAAGCGTTTCTCGGGTTCCTCATATGAGGCATTGCTGGTTACATACAACCCGGATGTCACGGGTGCTCGT
AGAATTGTGTGTCAACTGTCGAGCGAGCTCGGACTATCTATTCAAGCATCGAGTCCGCAGGCACCATCGGTCCGCGCTGGCGAAGACGAAGTGCGACGAT
TTACTCGGCTTTTGTTCTGGAGCTGTCTTCTGTCTCTTCCTGTCATCATCGTGGAATTTCTGTTGCCGGTGTTCTTTCCCTTCTCCGGTGACAATCCAGC
TGATGCTGCACTCTGGGGCACTGCGAACCGTGTGAGTATCAGAGCTGCTGTGGAAATGGCGTGTGCGACGCCAGTGCTGTTCATCGTGGCTCGACCCATC
CACGAGAGTGCCTTCCTCTCGTTGCGGTACGGCGGCCGAGTTTCCATGGATGTTCTCGTCTCGCTAAGTGGCTGCACAGCCTACGCCTTTTCTGTTTTCA
CTGTGGTCACTGAGGCACTTGCGAAATCTCGAACACTGGAAGTAGTGCCAGCTCAAGTGGATCCTTCAACGGGGTCGACCTTACCCCCAGCTCTAGAACA
AGTGGAGACGCAAGCCAAAGCAGAAACTTTTTTCCAAGTCACAGTACTACTCATTACTCTCATCCTCGTTGGACGCTACATCGAAACGTTGGTAAAGGCA
CGCGCCTCAAACAGTGTGGATGCATTGCTGCGAATGCAGGCCAAGACCGCAATTTTGCTCGAACATGAGGATGAGAAAGAATTGTATATCGATGTGGTGC
TTGTGGAACGTGGCGACCTACTTAAAGTTCTCCCTGGTACGCGGGTGCCTACGGACGGTGTGGTTGTCAGAGGTGCTAGCTCTGTGGATGAGTCCATGGT
AACGGGTGAAGTCCGCAAGGTGCCTAAGGAAGCTGGAGCAATTGTGATCGGTGGGTCCATAAACTCACAGGGTGTATTGACCATGCGAGTAACACATACC
ATTCACGAATCGATGTTGGCGCGCATGGTGCGGCTTGTGCGGGAGGCCCAGGCTTCTCGCGGTGTGCGCCAGAGCATTGCGGATGCTGTGGCTGCTTACT
TCACCACGTTTATCATCATTCTGGCTGGCGTCATGTTCATGTTCTGGTACTCGCTGGCAAAACACGGTCGTGTGGATACACAAGGGTGGGCTCCATTCCC
GTTTGCGCTGCGCTTTGCGATAACAGTGCTAGTTATTAGTTGTCCATGCGCGATTAGTCTGGCAGTGCCTACTGCAGTGATGGTGGCGACGACAAAAGGC
TCGCAGGTGGGTATTCTTTTCAAGGGCGGTCGTGCgttggaggcgctggaggaagtGGATGCTGTCGTGTTCGACAAGACGGGCACGCTCACCACTGCGC
AACTTGGTATAGCTAATGTCTTCACGCCTCAAATCGGATTCGACGAAGCACAACTCTGGCGTTATATAGCTGCCGCCGAGAGCGGCAGCGAGCACTCCAT
CGGCAAAACTCTCGTGGCGCATGCTGAGACTCAAATAGCAGATTTTCGGGTCGATCAACCGCAGTGTTTCGAGGCTGTTCCAGGTTGTGGGGTGCACTGC
GCTGTGGGCGGTGTTGATGTTCGACTCGGCTCGCTTACATGGCTGAAGGGGCAGACTTACGGCGAGTGTCGCGCTCTTAGGGTCCCTGCGGAGTTTACTG
AAGCAAATCAGCGCTTCCAGTCTCAAGGCTGTATTGTGGTGTTTGTTGTCATTGATGGCGAGTTGGTATCTGCCATTGCACTCCGAGATGCACCGCGTCC
AGAAGCCAAACGTGTCATTGAACAGCTGAAGCGGGAGGACATTCAGCCATGGATTGTTACGGGTGATCAGCGTGGCACAGCAATGAGtgtggcgacggcg
ctggGCGTTCCAGAAGGCTCTGTGTTGGCTGAGAGTTTGCCTCATCAAAAGGTGGATAAGGTACGCTTGCTGCAGAGTCTGGGTTTGCGGGTGGCATTTG
TGGGAGACGGTATGAACGACGCGCCAGCGCTAGCCACAGCCAATATTGGTGTTGCGCTTGGGGCCGGTACTGATGTAGCGATCGATGCTGCCGACGTCGT
TCTAGTCAAGAATGACCTGCGCGATCTACTCAATGCACGGGCACTTTCGCACGCAACCAACAAGCGCATCAAGCACAACTTTGCGTGGGGGTTTATGTAC
AATCTGCTCATGATGCCGGTGGCGTGTGGGGCGTTGTATGCTCCACTTGGAATTTGGATTCCTCCAGCCGTTGCTGGTCTGTCGGAGTTATTGTCATCGG
TGCCCGTGATTTTGTTCTCCTTGTTGCTTAATCTTTGGAAACCTCGCTTCACTGGTGACTGgggccagcagcaacatcacgTAGTCATCGACGTGTCCGA
GTCGACgcctctgctgcagaagcaacgGTAACTTCTCCATGGATGCACCTGGGGTCGAGATGAAGTACCAGGTAGATATATCATGCAGGGAATCAACAGG
TTTGTTATTGCCTACACTGAAGTTATGCTCTGTTCTCTAACTCGAAGTGGATGCCTTGGTGTACTTGAGGAAAGCAACTCTGGCATGTGTTCGTACTGTG
TGAATGTCTACTTGCAGGACCTTGTCGtcacaagcaccaccagcgacaatAACATCAAAGCGGCGGCGAAGttcttcaacatcttcgCTGTCTGGGACGG
CGGAGTTGCAACTCTCTTTTCCGCTGTCAGCGAGCGAGTCATGTGCTGCGCGCATGTTGCGTGCAACCTTGGCGCCAGAGCCACAAGATAAATGGACCGG
AGTGGAAGCCGTTTTGAGTTTTTCCCCTAGCCGACAATCGTTCACAAAGGCGTCACGTCTTGCAATAGCCTCCAGCTCagcctgctcttctcgtcgctgc
tgccgttgcttctgctccgcgtcgagctcgtcttcgtctcgtGCCGAGCGTGGGTCAGGCTTCATCTTTAGCTGATATCGCCGCTGCATCGCTTTAAGGG
ATAGAGCGAGATACACGCAAGCCGAAGCACGGATCGACATTTGTGGGAATTTGGGACGCTCGCTGCCCAGCGCAAGCAATACCTCGTTGAGTGCtgctcc
aagctgctgctccaactgcCCCGGGTAACTCTTGGCTAGTGTCACCTGGGGTGGTAATTTCACTGGCAGACTCTGCGATGTGTACCGAGATGGCTCGGCG
CAGAATTGTCGACGTGCTTCCTCAGAGACGAAGAAGTAGACTTTGGAACGATACGATGCACGGAAGAATACGCAACCATGACGAAGTGCCGCCCAATCTT
TGGCGCCTGAGCCTGCTGCAAACTTGACGGGGCAGTAGCCTTTCAACTCAGGAAAGTCGCAGTCCGGCACAGTGAGCAAGCTCAGGAGCGAAGCATTTAC
TGGGGCTCTATCTACGAGTGTTTGTGCCTCActctccgcttcttcttgcgtaGGCCACAGTTCTTCATCCGTTTGAACGGAGTTTTGGTCCGGCAAACAT
CCGACGAAAGTCTCTGGACTCTCAACAAACAGCTCGAGATTTCGCTCGTTTCCTAGCCAGAAGCTGGAACCTCGGAAGTCTACACAGAGATTGCGGCTTG
ATTGACGAGATAGGTAAAACCTTCCAGCCCGCAGCTCAACAGGACAGAAAGTTTGGAAAATGGCGTGCTCACGtgcttgaagctcttcacgTGCACGTAC
GACACCAAACGAGCGAGCTGTTCGATTGGAAACCATCGCTCTGGCGTGGTGTGATGttaattgctgctgctcagaGAGATATGCTTGTGCCTGTGCAGCA
ACGTGCCAAAGCGAACTGCCCAAGCTGTCAAGCTGGCGTACGTGGAAAGCACCAAAGCGTCGAGTCCAGAAGTCAAGCAATTCCAGCCGGAACTGATGCC
AACACGCAAATGCTGCTCGGAGTTCGATCCTCTTAACGTGATTCTGATGATCCTGCCAGACGCAGGTGAAGTCGCGCTCCAGAATAAAGAGCATGTCTGG
TTGAATTCTCTGCGAAGATACCTCTGTCGTGCTGGAATTCTGAAAACTgcgttgcagctcgtggcgtTGCAGTAAGTACCCGTCGAGAACCCAGCCACGC
GTCTGACACTCTGATGATCGCAGACGAGCACAGATTGCGTCGTGGGTTACAGCAGCGTCACTTAGAGGGTTTAGTTGCTGTTCCGTGAGCTCCAGCAATC
GATGTCGCAATGTGGAGCCACCCTGACATTGCATTACCCAATCTACAGCAGTTTGCGGACATACGTAGACCAGGCCGAGTGTATTCGCGAGTTCCTGGGC
AACGCGTGTCTTGCCTGACAATGGAGCTCCTACCACACAGCAGGTTGACTGGTGTTTTGGTGGAAGACTTGGTTTGTCCAAATATTGTGAAGGACACGCC
ATAAAGGCACGACAGGCTTCACGCGATCGCGGAAAATAAAGCTGGTCTCGGTGAACGACGGCCTTCATCAATGATGGCGATAACGAATCAGTAATCCCAG
TAACAGGGCAGGCAAATCCATGTTTGCCGACAAAAAGTTCTCCTGACGCTAGTAGCTGGTGCATTTTGCCTCCTGCCGTCGTTTCAATCACTTCGCAGCG
GTCAAACAGCGTTTCTCGGCCAGTCATGAAGTCATCTAGGACACATCTTACGTGCTTGACCATTTGTCTTTGAGCACTGGATGCGTTCACCGGGTTGCAG
ACCATGATCCCTCGAGCTCGGAGCCCAGCGATTGCCTCATCCAAACCCTTCTGGTCCTCTGCAAATTGTTCACGGAGTCGAGTactctcttcttcacgcg
CCACTTCCAAGTCAAAaggttcttcctcttcttcttcggcctcATCTGGTGGACTACCACCgtcttcggcgtcgtcgtctatCTCTTTTTTTCGTGTGAC
AGCAAGCTTTcgtcgaggcgctggaagatTGGTAGCCCATCGATCCAACAGCGTCTCCACAACATCATCTTCCGACATTGTCAAAGGAATCACAAGCGCG
GGAAAGAGCCCATGCTTGAATAAAATCTCCAAGGTCGCTGCAGTCGGGATACGTGTAGCTTCAGGCCCCAATCCAGCAATAATCTGTGCCACAACTTTCT
CGGATGCTGGctggtggcgttgaagctCGAGTTGGAGCGCTTCGACATATATTTCTTCTCGTGTCAGTCGTGTTACTTCTGATTTGAGTTCTTCTAGCAG
TTGTTTGCGATCGGCATTACTTGCAACTACAGCCAAGTCCACATTGATGTACGCCGTCGAGGAGTTTAATTGTTCTGTTTGGGTCTGAGCAAGTGCTTCG
GTGAGTCGCCTCCGTCCAGACCCTCGAACACCAAGTATCAAAACGCAAGGAGCGAAGTTTGCACTTGCGCATGGCCCCTCAGGAATATAGACAGCTGGGT
TTCGCTCGAAGGCATTACGCTCCAGTTCACCAGCAAAGGCATAAAACTTGTGTCGGAATGAACAAACAGTTGACGGCAGTCCAGGTACCAACAAACCACG
CGTACGCCAAGACACAGGACAAAAACGTCCACACTCTccctgaagctgcagtgcccTACTCCTTGTGGCTTCAGCttgtgcttcagcttcaaaaTCTGTG
ACTTCGGCCTCATCCTCTCCTTCGTCGGGCGACGACACTCCTTTTCCCGGATTCTCGTCATCCTTTTCAGGAATTGGTGGGGCAAATATCACGGCTGGAT
CGTATTCATCAACGAATTGTGGAGCATGCCCGTCCTCGATACTGTCCAAACGTGGAGCGATCGGGTTGAGCTCGCGTTTGATAGCAGCAAGTGTATCATT
CGGTTCGCGGAACAGTGGACAAGTTATGACTCGAGGTGCATTACCAAGTCCTTGTGAGATGTCTTCGGCGCCAGAATTTTCAGCTTGAAATTGCTGACGT
CGCAGTGCTGATAAAGCACTAACAGTGCCAGGGTTCTTGTcgtcctgctcttcctgagctgcagcggcctCCCTGTCCAGTAACAAAATTGCGTTGGGCA
CGCATCTGTGCTCAAGCAGTATGGCGGCAACTTCACGTGTGAGAGGCAGGTCCTTGATCATCCACCCGGTCGACGGTGTCAGTTTGGAGGACAAAGCCTT
GACTGCTTCCGCAGCAAcggttgcagcttcaacggGGGAAACAACCTGTCCTCCCATGAGACGCATTTCCATCGAGATACTGGAAGTCTTAAGTAACGTC
AAAGGAGACACAGTTTGCACATGGAGCCCAGCCTCGACTGTCTCGAGGTACGATGGTGTGAAGATGTCGCCTGCACCTGTGGTGACAAGCCAAAAGTTGC
GATACTTAGACGGAGCTGGAACATCCTGCCGCAAAAACTGCAGCGGGTGCGCGCAAAAAGCTCGCCGTGCGTCTGCTGAGGTCAACAGGTAGACCCGACC
GGAGTAACATGCGGCAAATTCTGGATCACCTAGTGTTAAGGCGCTGGTAGAAGTTGACAAAACGGGACAAAATTCATGCCATTTCGATAGCACTCGGCGT
TTAGCATCACGCCGAGGCAGTCGTGCGAACGTCTCCGCGTTGAAACTTGTTTCAGCCTCAAGAAGAGTGCTCCAGTCTCCGTAGAGTAGCCACTTTACTT
TATCAGCGCGACTGGAATTACTCAGATCGTCAGGTAGGGAAATTGGACAAGCTTCACGCGAAATGCTGAACCGCGACAGACCAAGTACCGTCTAACAACA
AATTCCAAGTCAAGATCACAAGCAAGTCAAACGAAgagtcaagaagaacaatcATAAAGTGAAACTTACCCCTGTGATCGCCTGGATGCAGTGATCTCGG
ATTACATTGAGAGATTGAGTCGCCAGAACTACCACCAAGTGGCAGTTTGATCGTGTGTCGGCACTTTGCCACATTGAGAGCTCGTGTTGCATTCGTGACA
CGTACGCGGGGTATCCCTTGGCGAGTTTTACCAAGGCCAATGAACCTATCGGCAAAGTTGGTTCTCTAGGTGGCTCGATTTCGTTGCGTTCGGCAGGTGT
CGGCTCCGGTGGTGGTAAAGGTTCTTCCGGTGGTGCTTGGCCGCCGTCTTCGTTTTCTTCCTGATCATTTTCCTCTGGACGGTCCTCGCCAATTTCTGGG
TCTTCGCTGTTTGGATCAGTGCCACTGTTTTCAATTACAGCATTGGgttgttgcagctcctcAGTTTCAACATCGGGCGTCTTTGGAGGCAAGAGAAAAT
CTGCgaagcctccagcagccaagTCTTCTGGATTTGGTGTTGTCAAAATGGCCAGCTCCCGTACGGAGTACAAACGTCCAGCTATTGGTGCCACCACCGA
GCCTCGAAGCTGGCGCTCAAGCTCACTCGGTTGCGCTGTGAGAGCTACTAAATAGTCTACTGTGATGCTATGCTCTGGAACATCAGAAGTCAACAATTCG
TACGGGTACACGTCGTCCATGATCACCCCAACTCCAGCTACGAAAACAAACCACAAGCACGTCAAGTAAATGTCAATATTCATCGCTGCAATGGCTCGCC
AACGTACTGAGCAAAGAACGAGTGGCTTCGAGTCGAAGTAGAGCAACTGCTGTGTCTCTAGGAATCGCGTTTCCATCGATATGTTCATCTCGAAAAATAC
GGTCCATCTCTTCGTCCACTTCAGCGTTTTCAGACTCAGTTTCACCTTCTTCCGTTGTCTCCGCTTGTGGCGGAGTTTCAACAATTGAatcttcgccatc
tccatctgcagcagtagctACAACAACAGTTCGACTTCGACGCAGTCGCAGTTTACGGTCGGCAGCACGCtgtacagctccatcaaGCGAGAGATATTTC
AGCCCCAGCCGTCGTGCTAGCACACGAGCAAGCCGCGTCTTACCGGACCCAGGAGGTCCAACAACCGCAATTCTCAGTGCTGGAAATTCAGTTAGAGCAG
CGGTGAGTGCGTCTTCAGGATTCCAATACGCTTGGGTCTCGCTGTAGAGTTTCCTACTCCGGATCGGGGTTGCTCCAGTTCCGATAGAAGCCACTAGCTC
CAAGTGCAGTCGTTTTGCTACCTCAGCTTCATCGAGTTGGGAGTCGTCTTTGGTATCTGTATTGGCCTCCTCTGCTACATTTGCAGCACTTCCGTTGATA
CCAACactgtttttttttgttgGGAAAGCCCGACTGAGTGAGAATTTTCGTGGGTTGTAGCtcagaagaagctgcttgagcgACATCTCGCGTTGGTTAG
GAAGTTGCAGTCCCCGGATACCTCGAAAGGCGTCACTTGATGGGGGAATCTTTTGCAGGAACGCGTCGTTGGCAATTTTCGGGATACGATTCAATGGTCG
AAGCGTAAGGCGATCACACAGATCACCAGCCTCATTATGCTCTGGTTCACTGCCAGAAGAAGATACAACCTGCTCCGCGACAGAATTTCGTAGCTCCCTG
AAGAAAGTAATGAACATGTTGGTGGCACTCTCCACGGGTAGAACAATCTCAGCGAGCTGCATGACCGCCTCGCGAAATTGTTCAGGTGACAAAACTTCGT
TCTCCaaacttgaagctgctttaGTGGACTTGTCAATACTGCCGACACCTTCCAGATCGTATTCCCAGTCAcgttgcgctgcagcgatTGCAAGCGAATC
CGTTGACAATGGAAGTACCAGTGCctttgcagctcgagcgaaAAATCCGACGTAACCCTCACGATTCAAAGTGCAGGAGCTCATAGGTTTGGCCAAATCC
CAGAGCAGTGTCAATTCGCGTGCCACGAACGCATTCGCTTCACCTCCGTTGGCAGACTCGTCACCTTCCAGCATCGCATTTCGACGATTGTGCCATAGTT
GCAGCAGATTGGCTTTACCCTCGCCAACACTACGTTCCCTTTCGTCCtcagcgaagaggaagtgCCGACGCATCGGAACTCCAAACCGTTCTTGATATCG
CCAACTTGGATCGATCTAGGACACTGGGGCCGCCGCGACGGCTTGGAAGGGCAAGAGCAGAAAATGTTGGTTTCAATTTTGTGTTTCATTCCCGTTTTTA
GGatgctgcactcgctgctaCGAGAGCTTATAAGCGTACACGAGTTTGGTGGTGATAGTTGCCTTGAGCTTCTATGCTAGACTTCGCGATGTCAGAGTGA
CTCGAGTCGACTCGAGTCCAATTTCTGCGCTGGCAGTGCGAACgcgtgtcttcttctcgcttgGACGCTTTTGTTTCATCATCAACTCctcgcccttctt
cttgaaaatGTTGCCAATGGACTTTCGTCGAGATTGATGCCTGGTCGTTGCAGTGTCCTGAGTCACCCACGGAtgctgcaacgctgcagccactGAAAGT
CTCGACTTGGGCTTCACATCCAAGAGACCAGCTAGCAGCTCGACGCATGAATCCGGTACCTGTGATAGCAATCCAGTCTCCTGGAGAGCAAATAGTGTGC
CACGTTCAGCCATCCGACAGAAGAGTTTGTCGCTGTCAATTGATGCACGACGCACCAAAGCTCGCTTAGTGCACAACGTCCACAAGATCACACCAAGGGA
CCAGGCATCAGCTTGACGTGCatcgtccacctccttcttccgTAGCAGTTCGGGCGCAGCATAGGCCTCTTTCGCTACTTGTTCGACCTGAACACTCGGT
CGGTCGAGCTTGAATCGTTGGGCGTGGCCCAGATCCCCTACCTTGGCAGCACCGGATTCCGTGACGAAAACATTTTCCGGCGACAAATCCAAGTGGGCGA
TTCCGGCGGTATGAAGTTCCTGAACTCCTCGAAGTACAGCGGTGAAGATACGACGTCGACCTGCATCGGTGCAAGTAGATATTGCAGAGTTTTGTGTCGG
CACCCCTGCCGTTTGAAGACGAAGTTCTTGTTGCATGATTTCGAGCACATCTCCACAACCGCAGTGTTCTTGCAGTAGATGGAGTCGCTCTCCTTGCAAA
AAATGTTGCTCCAACTTGACGACGTTTTCGGTATCTCGAACCGAGAGGTGGAGATCCAATTCATGTAGTGCAGCGGCACTGGCGTTGCGGCCTTCAAAGG
TGGACGAGGTCATGAGCGTGTGCTTGTCGATGAAAACGCGCCCTGAAACAGGACACTCCACCAGATCCACACATTGGAGACCATCGAGGCTTTCCTGTAT
CCGCGAATGCAGCTTCATACGGGCATTGGTGACAAGAGCCATGAGCTGCACAGTTGATGGGGCTTCCTTCACTTCCCACACGGCGTTTTTCAAACTGAG