Description :
From Genome Similarity Track
Location :
scaffold_13:498354- 499637
Transcript NameFunction/comments
Plaha_PHALS_06197Mannose-binding lectin
Plaha_PHALS_06198hypothetical protein

Sequence
1283 bases(100 bases per row)
AATTGCATCCTCATGAAACAGAATCTCAGGTGTCTTGTCTTCAAGTAAAGCCGCATGaatactatcacgtggatgTCCATCTGCATCTAGCAATGGAAGT
CCATCGTCGTGATGTGTCTTTAGTTCCTTGCGTGCCATTTAACTTGTGTCGTATCAAGTGAAATGTGAAATATATATGGCCATTCAACGTCATCTTGTTG
TGCGGAGAAAAGGCCAGAGCGTCTGTTTCGTGTTGAAATGTGTCATTTTTCTGTGGCTGGCATATGTGGTACGAGTCTTCTAAGATTGAAATATAGATGA
CTATGGACGTGGAGCAGGACGCATTACCGCATGAGCAGGACACACCACAGCATGAAGAGGAAGAATCTCGACATGAGCAGCAGTTTAAAGCGCTGTATAT
GACCCAAGTGCTAGCTAAGCTGCATGAGAGTAATAAAACACCGCAAGTTGCTGCAGCAGAGCTACAAACTGCGCTGGTTTGATTGTCTTGATAagaacat
ttaatcgtgATAAACAAGATTTTAACGTCGAGATTGTCATGTAGAGAGAATTGCATGTTTTACAGCAAGAATTTGTCACTAAACAAACAAAGCAAAACTT
ACTAGATCGTCTAGCACAAGTTGAAGCATTGGAAGCTCTTCAGAATACTGCGGCATCTAGAAAAGCGAAGGCAGAAACTGgttttgatcaagaaaaaaaa
gaattacAGACTGCAGTGCGTGAACGAGCAGATATGCTTCGTTTGCTGGAACGACTAGCAGATGAAGTCGAGCAACAGAAGCAAAAGGTGCTTGACCATG
AAAGCACACGGGAGACGCACGAGAGTGAGGTAGCGCAGCTGAACGAAGTGTGGAAGGAACTTCAGAAAAAAAATGCTCATCGGAAAGCAGCAGTACAAGT
AGCTACAGGCGTGATGATTACGGACGAAGAAGACTGTGCACGAGTTCTTGATCAGCAGACTCAAAATATTCAGGAACTGCATCAAAAACAAAAGCAGCTT
GAGGTGAGCAATGTTAAGTGGATCTAAAAAGAATCTCATTTGATTCTCTTTATTCGTGATCGAGCATGAAGGATGAAAAGATCGATATAAGCATTAAAGT
AGCGCGAACGAAAAAGACGATTGAAAATTTGTCAAAAGAGGTGCGTAAAGGAATGATCGAAATGTTGGACAAGTGGACACTTAATGCGATTATTGTAGAA
CGATCTGAGAAGTAAAGATGCGGAGGTGAAACAGCGAGAACAGGACTACATGACGCTGCAGCAAATGAAGCAGTGGTGCGTAT