Description :
From Genome Similarity Track
Location :
Scaffold_583:4983- 7829
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_583-snap-gene-0.11SPX domain-containing protein
Pytul_var.sporangiiferummaker-pug3_contig_583-snap-gene-0.13Vesicle-associated membrane protein-associated protein A

Sequence
2846 bases(100 bases per row)
NNTGTCGGCGATCGCGGCCATCTGGCGGTGCGAACAATTGGCTACTGTAAATGCAGGGTAAATTGGTGCCGCCATAGCGAGAACCACCGCGTTCGGCATA
GACCAAGTTATTAAGTTTGCTCCACCCAGGTGTGTGTGTGGTAAGGAGACTCTTGTGCATGCATGTTCGTGCGCATGTGTATGCTTGTTCGTGTGTATGT
GCATGCTTTAGCCAGTGTGCGTCTGTGTATGCATGTGTGAGGCAAAGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATTCCATGATTCTGTGATGCTTAAACGGAACGAACGCTGG
AGGAACGCGGTGGAGGAGGGAGAAGGAAGAACGAAAAAAAAAGGGGAGCGAGTCATCGAACGCGGACGTCTGTGGGACGCGCTTATTCGCTCTTTTTACC
GCTTCCGCCCTCTCGACACGCAGCTTCTTCCGATTCGGGCGGACATTCACACCGTGGCATGTGGGTGCAGCTCGACCGCATGCATTGCATTGTATTCTAA
GAAATGCGCAAAAAGATGAAGATGCCAATGATGATGGAGAGCGAAAGTGTGATACGATACTGACTGTGTGTATGTGTGAATCTGCGTATGTATGTGTGAT
GGGATTTCTGTGCAGAACGCGTCAACGAGAGCTCTGGACGGAAAAAGGAACAGCGACAAAACGAAAGTTGCATCCCGTGACGACGACCAGCGAAGCAGGA
GCTAGTGATTGGGTGCCATCGTACCATTGCGAGTCGATAACAGCAAGAGCAGTACACACGTAGGAAGTCAACATTGCAGCACGATGAAGTTCGGCAAGGT
GCTACAGCAGTCGATGCAGATGTCGTCGTCGTCCTGGGAACCGCACTGGGTCGACTACAAACAGCTGAAACACATCATCAAGGACTGCGCGCATATCCAG
AAGGAGGAAAAGTTGCAGGGCGACAAGCTCGTGAAAACCAAGATCAAACCATCCGCGAAAGAAGACAACGACAGCATTCGTACGTTGGTGAAATGTGCAC
ACATGCGTGTGCGTTTGTAGCTAAACGAATTTGCTACATATGGGTTTGTTTATGCAGGCAAATCGCCCGATGAGATGAATTTCTTTCGCACGTTGCGCGT
CGAGATCAAGAAAGTGGCCGATTTTTTTGTGCAAGAGCAAGCGAAACATACCAACCAGGTTGCAGCCATTGAGCAAATCTCTATCGACCTCAAGGTGCGC
ATTATATATATGTAGATGTAGATGTAGTTGCACGCGAATGGCCAATAGAGTGCTAACTTTCATCGCTACTGGACATGCTACGAATAGGCGTCTCCAAAGC
CCGAAACTAAGACTGAGTTGATGAAAAGCTGTGTGTCACTGTACAAGGAATTACTGCTGCTCGAGAACTTTGCCGTGATGAACTTTTGTGGTATCTCCAA
AGTATGTGAAGCGTGCAATACAATGCCTTGTTTGTGCATTGGGTCATGCGAACGTGACTAACAAACATTGTGCGCTCTATTATTGCCACGAACAACATAG
ATTTTGAAAAAGCACGACAAGTGGACCGGGTACGCGACGCGGCACAAGTTCATGCATACGATCTTGATGAAGCAGCCGTTTGCGACGTACGTGCCGCTGT
TGCAGATGATCGACCGCTTGGAGCACATCTTTATGGAGGCGACGGGCTCGAGCATCGACCAGCACGACGCGCAGAAATCGGGTCGCCGCGGTAGTGGCGG
TAGTGGCGCCGGGGGCAGCGGATCGTTTTTCCCAAATGGAAATAATGGCGGAGGATCTCGAACGAATTCGCCACGTAGCAGCCGCCAGAATCACACGCCA
GGGAACTCGCCACCGTCCGGGGGAACAGGACCAGGAGCAGGCACGTACGGGGAGTATTCGTTCGGTGGGGAACACCAGACGCGCGACTTATCACCACGGT
CCGAGGATTCTGTTCCGCTCGTGAAAGTGCATGCTTTGAGAGGGGATGCATGGCAACTGAAGCAAATGGAAAGCGTGGGAGATTACGATGGCGACGAGGA
GGACGATGGTGAAGACGACGGCAATGACGATGGCACCTTCCAGGACGACTTTGCAGCTTCTCCACCGCGTGAAGCTGAAGCGAAACCAGCGTCTGTAGTG
ATTCCCGATGTGCAACCGCAGGCACAACTGCAAAGTGTTTCTTCTCTCGGCCACCACTCAGACAGCGATGCCGCGGCGATCGCCATGCTTTCCATGAAAG
AGAGCTTAGCCAGAAACGGTAGAGACCGCATTCACGGCTCGGGTATCAGCAGCGATGGCGGTGAAAGCAGTGGCCCCGACGGCCGTGGTCACTACAACAA
GCGCAAAGCGTTTGCGCCATTGACGAGTGTCAGCGCCGGCAAGCGCAAGATGAGTTTTGCGACGATTCTCAATTGACGACGTGTGACTTTTTGTTTTAGC
GAGCGCCGGTCACATTAGGAAGTAGCAGAAACGAGTTGCCATCGTGCTAGGTGAATGAATATTAAGAAGCTGGAGGAAAGCAATAGAAGGGGAAAAAAGC
GCAGTGAGGATGTTGTTGTGGCTGTTGGTGTGTCCGTTATCACGCCTTGTTCCCTTATGTTTCTTCTGTGCGAGCCTACTTGGTTGTGAAAGCATAATGA
GAGGGGGTGCGAAGAAGCAACGGTGCCGAGATGCTAAACGAAAGCTATCCTCCCACATTGGAATGAACAGGATCCAGCGGATGCAACAGTAGCTTTTTCT
TCACCTCAGTCGTCTCGTTCCTTTTGTCTCTCGCGAGGCTTCTTCT