Description :
From Genome Similarity Track
Location :
scaffold_35:49810- 51912
Sequence
2102 bases(100 bases per row)
gccgggcagcatacacacctTNNNNNNNNNNTGGGCTGACATCACTAGCccttcggctattcctccccctaCCAAGCCTTaagtcatgggatggcggcgt
cagcgggacgtgagggtgaatcagcccgttaacgtagaacggcatgtagcctgtagacgaatgcactgcattgttcagtgcaaagcataggagtggcagc
atggcgctccagcgcctcggtgtcttagcgcagacgctgcgaagaacgtcttcgatgacgcgattcaccctttccgTTTGACTAttgtctgcggatgatc
cgctgtcgacatatccaacttggtgccgagcacattgaagatagtcgaccaaaactctcccgtgaaacggggtctctgtcagagacaatcgactgtggga
gtccgtgttgacggaaaatacgatccacgaacagcgttgctgtaccgactccatcAATGGTGTCtagcaccgccgccaaataagccatcttgcttaaccg
gtcgacgaataccacgacacccgtgttgcccgccgattctttcggcaggccaaacacaaagtccaaactcatggacgacgagcacccagtgggtacggTT
AAGCTGGCCaacggcgcagccgcatctggagagggtttcacctgttgacacgtctcacacgtgcgcacagaggtgctcgtccatttgtacaacttgggcc
accaataatggtgactcacagagttgtacgttctcTCACGAcagagatgaccactgagtggcgtgtcgaacgcctcatagaggatgcggtatttcaaata
ctCACCATGAGGAACTACaactcgtggtgtatccgttgattcGGTGTTATAATATAGAACCCAttatttaacgaatatcggtgcgatcgtgcacgcagtc
ttgatgacaatttcatgtccgagtttccaaactccttgctcccgagagcccgaagcaacgctacacacatcccatcacccgcatacgcggtgcggaccAA
ATCCGACACAGACGACAATTCAGTTGTGacatgagctagctcatagtctggtctgcgtgacaacgcatcagccaaagcattatgCTTTCCCGGCTNNNNN
NNNNNtagcataatttaacaaaataccccacaatgACAAAGTATACAGtaatatgctataaccattcagtttactattaaccaagtaaCGCTAAATTAAT
gaatacgtgacttctaaccaggtcccacattagctcagatggtagagcgcttgcaaaaNNNNNNNNNNAGTCGTTCTATacctagaacaagtacgaatta
gcggatcgcaatccgcttactccgagAGTATTTATTGctttacccaaggctaattagctcttccgtttaaaatccaaaactgatttttatttatttattc
taatttttaaagtttagattttcctaaatatactaaatatatatagtaaagtctcaatacatgcataactactggctacctagctcTTGtctgggtgtgg
tcacaccatgcacatctcgtgtgacacacacccctgttaccagattACGTGTAATAACCGCTGCCATTTGCGTGACACGCACTATTTCCCTAGGCAAGTG
CCTCAGTCTAGGGCAACACCGTGGCGGAGAATCGCTACCACTTGTTGCATCCTAGCGGGGGTAACTTTCACACTGCTATTTCCTTTACCGAAGGATAGAA
CTGTTTCAGAGTATCCTCGAACATAGCTGATCCATTGCTGGTTCAGTCCGCAATGACTGGCTCATCCACATCGGATAAAGAGGCAGATCCTCTAAGGGAG
TACTCTATTATCGTGTCCACAAATGATACGAGTCGGACTTAAGAGAGGAGATTAATGTACCATCAATGTCTGGCAAGTCAAGAGCTTCTAGTACCCCGTG
CATTTCCTTGTCTCGCTAGACAGCAAAACAATTAGCGCATGTACGCATATGACACGAATAAAATCTTCGACAAATAACACGAATAAGTCCTTCGACATCA
GAGTATGCAAATCAAGAATTTTCGTGGCAAGTTTCACTAATGGATCGTCAAAACTAAAGTCAAATAAAAGCAAACCATTCACCTAGCTGTGATCACAATG
AT