Description :
From Genome Similarity Track
Location :
Scaffold_248:49807- 52451
Sequence
2644 bases(100 bases per row)
CGGCTGATAGTATTGTTCACTGGGGCAGTTTTCATATCACTGCGCTGTAAGAGATCTTTTTTTTTATCCGCAATATTACTGACCCGTCAAAGCCGACGAC
CAGAAGCACTTCGCCATGCCTGACCGTAGGGGGAGGCATGCTGATGGTTTGTCCCGTTTGCTTCGTGTTGCGATCAACATCTCGTCCACCTCCTCTCGCG
CGGCAATACTCGCCGCGAGGGTGCCGAGGATTTCGTCTTCCCCTCTTCTTACATCACTAATCTCCAACGTCCAAATCGACAGTAAAGTAGGAAATCTCCC
TAGTCTCCCATTGATACCCGATGACTGCATCAACCACGCCAAAGTAAAGTATCTCGTGAGCACCTAAATGTCCCGCGAGACCAAAAACGTATTTCAAATA
TCCAATATCCTGAAGCAGGGCCAGTATTTCTTCTCTACTACTCCGTGGATAATTTCATTTGGTTTTAAGGTTCGACTTGGGAACATAACAGGTCAATTGT
CTCTATCCTGTTTTGCAAAAAAGCTGCGATACCGCCCATTTGCAAGCATATACCACGGTAAATGGTCGGCCGTCCGGATCAAGATCTCTGAGCACCGGGG
TATGAGCTACTTCAGCCTTCAACATGGCGAACGCAATTATGGCTTTATCCCAACGATGATTACAAGTATGTTTTCCATCAGACTCTTTTACTTTGAATTT
ATCCTGACCATTCATTATCACCAGCTAATGATCGTCACCTGCATGCCACTGTTCGCGGTCGTCATAAATCTGGGTACTGCGGACGTGATTATAATTAGTT
GAACAATCATTATCTATGTTGTGCAAACGCCCGGTCCCATGGAAATCAGCTTCTATCAATTCGTACAGGACGGAGGCGTATATGGAAAAGTCTTCACTCA
ACCGGCTGTAGTAGTTCAGGCTTCCTAAGAAGGACTGTATTGACCGCAATGTCTGGGGAAAGGAATATTCCTTAACGACCCCAGATCCTTCGGATCAGCT
TCTATTCCATTTATTGACACTTGTTGCCCTAGGTACTCAACCTTACTTCATTCTCAAACACTGTTAGGTGTGCTTAGCAGAAAAGTCAATTGATCACATA
CTTCCAACAATCTGTCCACCTTTTGATAGAGAGACGTCCGGGATGACTCCGGAATTAGAATGTCATCAATGTAGGACCTCCGTCCTAAAACAAAAGGACG
TTAATGCGGGTTTGGCTCGCCGTCTGTAAACACATCGACCGGTTTAGACGCCCCATGATCACTTGACTTCCGCCGATCGCCGATCGTAAGATAACCATAC
AATGCGTTATCCACCATACGTTGATATATCTGCGGAGCATTCCTTAGCCCGAAAGACATGCGTAACCATTCATACAGACCCGAAGGCGTAATAAAAACAG
AGATCATTCGTGCTCGTTCCGTCATTTCTACCACCCAGAATTTGCTGGCCATATTCAGCGAACAATACCAAAGTGCTTTGTCTAGATCCTGCAACAAGTC
GCTGATCAAGGGCATGGGATATACCATCAGCCTCGTCAATTGGTTAACTCTTCGGTAGTCGATACACAGTCGTATATCCACTCCATTCTTCTTCACGATC
ACTACGATCGGCGACTCCCATGGTGAAGCTGAGGTACACATGATTTTACCCGATAGTTACCCTTTGATCACGTCCGCCAACGTTTCGCGGAACGTTGGGG
CGACTGGACTTTCGTTGTGCGATTGGGGCTGATCCTCCGACATCTATATCGCAGATTACGCCTTGCGCAGCAGGTGGGAGGGAGTTTACTTTACCCATCA
GTAGTTTTTCGTTTCTTCCAGATCAGCTGACGCAATTCTTCTTGTTCCTTGGTCAATGGGACCTCCGGCCGCCCACCTGTAAGTCGCCAATTTTCACCTC
ACCCAGCATCACATCTACTTCTGGTAAGACAGCCATATGTTGGCCAAAAATCCTCTGCGAACAACACTCCACTCCCATAATGATATGATAAGCAATCGTC
CGCTCTTTCGCTTGTGATTGGTGTCATTTGGCCCCCTTGATGGTGGACGGTCGATGTTCCTCACATTCCTTACGGGTTATTACGTTTGCGTGATGGGTGG
GCCGGTCTTGCTCGCGATTAGAAACTCTTTCATTGTCCAGATCGGGAGTGAGTTCATCAAACAGCTTTGAGGCCGTGTTTCCTACTGATCTTGCATCATC
TCAACGACGTTGTTCACATCGGTCATCACTGACTATCGCGTCGGTCGTCTTTCCTCGAGGTCACCTGGTTATTCAAATAGATCATGCTCCGACTCCCGCA
CCACATCAACGTCACCACCGTCAATGGTTGCACCAGGTGTGCTGATCACGATGATAACCACCAGCGGCTATCCTGATTGTCGTTCTTAAGATCATTTTTT
TTGCCAGCGTAATCATATATTGACGCATCGCAATTTAGCATTGCTTCTTCTTCTAACCATGACCGATGCTTCTGTATCCTTCGACGGTCGGTTTAAAATA
TACTTAGGTGTCGGGTATGACGGGTGTTCAACCGTAGGACTCAGCTATATCAGGCAATGCTTCTTCCTCCTCTTCAATGGTTGTTTTAAACACGAGTGTC
TGCCACTCCTGATATCGCTGTGACCCTACGGAAACATACCCGGG