Description :
From Genome Similarity Track
Location :
Scaffold_80:49804- 78465
Transcript NameFunction/comments
Phyta_totarag3112hypothetical protein
Phyta_totarag3113hypothetical protein PHYSODRAFT_466927
Phyta_totarag3114hypothetical protein
Phyta_totarag3115hypothetical protein PHYSODRAFT_353505

Sequence
28661 bases(100 bases per row)
GTACTCCACACAAGATACATTGTCGCGAAGAGTCGCAAAACTCCCGCCTTTTGGCTATCTTCCGCACTGATCGAGTTGAGCCAAGAGACACGAGACACAa
cagacaccagcagcaaacaccTTGAAGGCGGCTAGGCCATGGGACAGCAGGCCTCGCTACCGGCCGCGGTGACACAGCCGCCGGGCGAGCGCGCGCAGTT
GCGCCCACTGCAGGCGCCCTACGTGCCGCTCTACGACGTTGTCAAGGCTGGCGACTCCGGCGGCGCGGTGGCCTCAACCGCCGCCGAAGATTCAAAGGAC
GCGATGGACAAAATCCTCGAGTTTAGCGCCGCACTGCGCTACCTCCCGAAAGGTGACAAACCAATACAATAGGACAGAAAGAGAGAATTGCAATCTGACG
TTGATGTTGTTCTGTGATGACTGTTGACTCGTGCAGAGATGGAAGTGTCCGGACACATGCAGACGCGCAGTCCGGAccagcagatgaaggagctcaTGAG
CTCCGTAGACTCGGTGGACGAGTTGTTCCAGCACATTTCTCAGCTGGCAGGACTGCCAACGAAAGATGGACACGACCCTTCCCGACCCGACGTCGCTGGG
GAGGCCATGCCTGGCGTATTTGACGCCCGTGTGGCGAGCTACGTGAAGAACTTGCAGGCGGTGTACCAGATGACAAAGAAGGAGAAGTACCGGTACGAGC
AACGACTACTGGCTGCGAGGGCACACTCCATGTCCCTACGCAAAGTGTCGCCGCCACCGCTGCCACTACCAACACAGAGCTGTCTGACCATGGGCTGGGA
CCTGGTGGCGATGCTATTGAAGGCCACACGCAAAAACAACCCGGAACAATATGAACAAGCACTGCAGATGGTCAAGGAAAATCTGAAACCACTGAAGCCC
ACAGCCTACTCGGACAGTATGTACCTCGCGCCGTCCGCGGCATCAGCATTCAATCTACTGAGTGAATGTCTGGGTGATCTTGCTTATCCTGTGACGGATG
AAGCGTCTGAAGGCGAAGCGCGCATCGGAGCTCGCACAATCGAGACATTGGCTGAGGTGGGACTGGCCCGCGGCTCGCTTGCTACTATGCTCTTCGTGGC
ACTTTGGCTAATGAAGCAACCACCTACGAGCTCAGTAAATTTGGAAACATCAATAGCGAAACTCGCCGCACTCAAAGAACAACCCATGTACGGAAAGTGC
GAGGCGTCGGGGGAACTCTACAGTTGTGGGCAGAACTCGTATGGAGAACTTGGTACAGGAGACGACATTGAGCGACACCAGCTTACCAGTGTAGCACTTT
GTGGATGGGACGATATTCGCCAGGTGGTTAGTGGCAACGAAACACTGGCGGTTCTCACGAATGATGGCGCTGTACTAACTTGCGGACTGAACAAGAGCGG
GCAGTGCGGTCAGGGGAACTTTGATGAGCGAGTGATGATGCTCCGCCCCGTGCAGGCTCTGCGCTCCCAGCGAGTGAAGTCCATTGCTGCGAGCAACGGA
TGTGAGCATATGATCGCGCTGACAGACTCCGGGCTCGCGTACTCGTGGGGCTACAATGACCGAGGGCAATTGGGACATGAAAACTTGGCAACCAAGATCC
ACGCCCCAAAGCTCATTGAGTCGTTAAAGGATAAGAAACTCGGGTATGCCTCTGTGAGCTACCACCACAGTGCTGTGATCACGGACTCGGGGGAACTCTA
TACGTTTGGCATGAACGATTGTGGTCAGCTTGGACTCGATCACACACAACACCAGTCGACACCACAGCTCGTTAAGAGCCTCGAGGGCACCGAAATATCG
ATGGTAGCTTGCGGACTGTACCATACACTCATCTGCACAGCTTCAGGGGAATTATTTTCCTGCGGAAAGAATGACTACGGGCAATTGGGTTTAGCCCACA
ATCGCCAGGTCAAGATGCCCACCCTAGTCTCTCTTACAAATGAAATGGTGTGTTTCGTTTCATGCGGCTACTACCACTCGGTGATTGTTACCACTGGCGG
CCGGACTTTTTCGTTTGGTCGTAACGACTACGGGCAGCTAGGAATCGGGAACAAGATCCACCAGAATGCGCCAAATGTCGTGGCCTTGTCTGCCAACACA
CGGATGGTGCGGGCAACGTGCGGATGCTACCACACTGTGCTGCTTTCAGAACAAGGGCaagtcttcgtcttcgggCGGAACAACAAAGGACAGCTTGGGA
ATCGTGGCAGCGCGGATGCATTGCTACCTGTTCCGCTTAAAGTTCGCCCAGAGAAAAATTCCCGTCGATGTgtggatgttgctgctggttttTATACCAC
CTCATTAATAGTGGAGCGAAAACGCGAGAACGATGATGGTGATTCCGTTATGTTGGATCAATCTTGTGTCGTTCCTGTTTGCGGTCGGGTCGATATAGAT
CGATCAGGAGAGGTCGAGGGTCTAAGTAATTTTGGTTCCATTTCCACAGTAGGCGTGTCGCTCTTCCGAAGCAAATGGTTTTACGAGGTAGAGGTCGTCA
CTAGCGGTTTGATCCAAGTTGGATGGATTGATGGCTACTTCCAGGGAAGCTCAGACCAGGGCGAAGGAGTTGGCGACCACGCCCACTCATGGTCGTACGA
TGGTAATCGCCAGCGACGTTGGAACAGTGGATCGTCTTCGTATGGAGAGAAGTGGAGAGCTGGTGATATAATTGGTTGTTTGCTGGACCTAACTACGCAA
GAGATGACATTTTTCCGGAATGGAGTCAACCTGGGCGTGGCATATTCTGAATTTAAGTGCTCCGTGGACGACAAACGGTCAGGTATGATGCCTGGTATCA
GTCTTGAGCGAGGTGAAATCATTCGCATCAACATGGGGCACCAGCCTTTTGCTTATCCCCCAGCGATTGGTCACGACTTTGAGAGCGTTTGTCGTGCAGT
GACAATGCCTTCTTCTAGTGCAGTGATTCAGGCACCAGCAGATCAACTGACGGGAGTTATATCAGCGCATCCCCCACCTTTAGAAGGATCCGCCTCAGCC
TTCGTTGGCAATAAGATATTTGTTGTTGGCGGGATGGTTGCTGACGAAGCCACTTCGCCCCAACCTACGGAACCTACAAATCAAGTGTGGGTGTACGATA
CTGAGGCAAAAAGTTGGGAGAGATGGGCGGACTTTCCTATTGGAATTTGCAACCATCAAGTTGTGGCAATAGACGACAACCAAATTCTTGTCCTTGGTGG
CGAGAACAATTGCGCGGCGTCGCGGCACATGGACCTGTACAAGTGTTCTACGGTGAAAAACGTAGACGGCTCACTCCCAACATGGACATTGATTCAAGCG
GCTATTGGCGCAGCGACGTCAATGCCCCAAGCTCGTGCATTCCATACAGTCTCAACAATTCACGCTCGTCTTGACACGATCGTGTTCATGTATGGTGGAA
AATCGGTTGACAACGAGGTTCTCGGAGACGCGTGGTATTTATCACTTGATGATTATGCTTGGTCTCGATTGCCTAGTTCGGTATCCCTCGATCCTGGTCC
ACGAATCGGATGTTCTTCTGCTGTCATTGGAGAGTGCGTGTACATTTTTGGGGGGCAGGATCGTGAAGAAAAATTCAGGTCCGACCTCTGGAAGTATAAC
ACATTTGACCGGCTCTGGCACTTGTGCCATGACGATAACATTGGAGCTTCGAAAGACGAAGCAAGCAGTCTATCCAGTTCCAGCACGAGTAGTGATTCCC
AGCCGATGCTGCCCGAAGGTAGAATAAGTTATAGTATGTGCTCTGACTTTGGAAACATTTGGATCTTTGGAGGCGTCAACCGGACAAACACCTACTTGTG
CGATATGTGGTGTTTCTCTATGACATCGCAAACGTGGaaccacgttgaagtggataCTCAAGGAGAACTGGACGGGTGTTGCTCGGCAGCGTTGTACGTC
CGAACGGGTGCAGTAACCGCTCTGCCCAACATATCTGATTTCGAGTCATCTACTCCTCAAGATGGAGACTTGTTTCTTTTGGGGGGCCGCAATAGTCTTT
ATGGAAAGGtgtcaagctgcagcaaagtTCGAAAGGTATGTTCCGTAAACTCGACAGAATCCTACAGTCTCGACATGACAAAAAACATATCGATGACTGG
GAAGGCAGGGCATGTGCTTAGTGCCCTTCGCGCGAGGTGTGGAGCGGGAAACAGGTCAACTCAGTATTGTGCGGCAGAGGCCTTAGATACTGCTGTTTGT
TTGCTATCTCATCTGGATCGTTTAGCTGGAAATGACATTCCAGTAGAAGATACAGACTCGGTGCAGCTGTCACGGTGTTTGTACCGGTCACTCTGCATAG
ACCCCAATGAGTCAACGTTTTCAGCACTGTACGCACTGCTGGAAAACATAACGTCCCGCTTCTTTGATATGGTCGCGCTAGTTGAACAGTCCAATACCAC
ACCACTGGTAACTCACGTATTGTACCCGTTGCTCGTGACGATAAGGCTGCTCAAGCTAAATTTCTTCGAGGTATGACGACTGACGTTTATTTTATTTTGC
GCTGTTACTTTTGAACATTCTACTAATCACTTTACCATTATCTATGCTTTGATTCTTACTAGTTTTCGCGAAGTTGCTTGGACGGATCAGAGATTGGACT
accaactgcagcgtctcaaCGTGGAGGAGTTCTCTATTCGATTCGTGAGGTACTCTTCACAATTGCAGACCATGTACCGAAGCTACCGATGTCAGGGGAA
GTATTGTGGTTCTATCAGGCGGTGAAGAAAGAAACCGCTTCGGCAATCTACTATGGATTCCCAACCCTTTTCCCATCCCTCTTGGACAGGTTGCAAGTCA
TGAATCGTCTGATGGTAAACAAACACAATTCTGAAGCGGAATTGACCCCAGCGCAGAAACTATTAATTCCGATGCTTGTTCCTCGCTTCACGTCAGCAAA
AATGTTGTTTCAACTGATAAGTGACCCCGCTGTTCTTTTCAAGGTGGACGGTTCGTCAGACGAGGTTGTTACTAAAAGTGTGATCGAATTTATGAGTACA
CTGTTGGATGCGCTTTGGCAGAAGACAAAAGATACGATGGAGCACTCATCAGAGGATATTACTAAGCTCATGAAGAGTCTAGATACTATCGAGTCAAAAC
ATGAATTTAAATGCCTCAACATCATGCTGCGCGCGACAATTTTCTGGTGTTCGTGCTCCATCAGTCGAGGCTGGATGATCATTGAATCGGTGTGCACGAA
GTTGGTGGCTTTCATCTCGGAGTGTCTGGACCAATGCCATGCGATGGGGCTCGAGCAGAGTCAACTTCTTCCCGTAGTCATCCAGCGCAGTTTCTCGGgc
aagttgctgccattTATGCTACTCAGTGTTTTCTCGTTACCCTCCGTTCGTGACGCACCCCCCGCTTTGCTAGATCCGTTCTGGTCTCAACTAGAAGACC
TCTCGGCAAAACTTCATGCAACGCTTGCAGTCCTGTGTAAGCATGGTCTTTTGCGGCCATCCGGTCCACGTATCGAAACGCCCGGTGCACTTGGAGACAA
TAGCGGTGAAACTGAATTCGTGGATACAGCGCTCGCATCTGTTTCAAAGGAGCTCTCAATATGTCTCTTGCAGCAGAGCAGCGGCTCTTCCGTCACGTAT
GGTCGAATTTTTAAGAGTTTGTGGGACAAGATCACCCACTCGAAGGGATACACGTATTGGAAAGTAAAAGATCTACCGCAGGACGCGGAGATCCGACGGA
TAACTATTCCTTCGGACCTTGCAAAGCTTTTTGGGACTGAAACGCTGCTAGTTAAAGTTCAAAAGTCTGGAACAGAATTTGAAGTATCAGATTATGACCC
AAGGAAAATTACCTTCACGCCCAGCCGGACCATTCTCTCGCAACATATGTATCCTTTGAGTGAGGGTCCATTGCCTGTTCCAGGAAAAGCCGAGGCTGAT
GTTGGGCTCCCCCCAGCGCCGCAAGCTCTCGCAAAGACCACTTCTCCGATCGCACGGTGTCCTGACAAAACCATTGAAGAAAGCCATGAGTGGCTTAAGG
ACTTCCAAAAAGTGGTAGCCTGGGTCGGAAGTCACTACGCCGCGACTTTGATTATCGGTGGTGCGTTGGACAGTGGAGTCGTAGTCAGCGAGCGGTGGCT
ACATTCCACACTGTTCCGGGGTGGATTGGAAGAAACATGGTCTGATACAAATAAGGTGGGTCGGAATGAAGCGCTCCTGCTACAAGTGATGGATAACGTT
GGTAGTGGAAAAAAGCTTCTGGACAAAGTGCGAAATGCTCTGGATCCTGGATCGGCTCGAGGTATCGCAAATCCACAGCTTCGGGTTGCGAGGCTGAAGA
GGCAAGACAGTGTCGAGGCAACACTAGAAAAAAGTGGTGGAATTGAGGTAGTGGACCGTGCGGTCCGTGCAACGTTTGCTGCTCTCTTGAAACATACCAA
TATCTCTTACACGACCGAACCAATTTCAAGTGAAGGTGCACTTGCAGAAACGGTAGTTGATGCCTGGAAGGCTGCGCTACAACTTCGTCGTTGGTAAAGG
ATCCGCGCGCTATTTTAACTGTTGTTTTAAATGTCTCTAACATTATTGTCTTGTTTCACGTGTAGGATCGTGAGAGAGCAGCAGAAattggctgcagctt
tcagGTAAACCAATACCCATCAACTTACGAATCTTCTGTACAGATTTTCTAAGATTTAATTGCTATTGCAGTGAGGCGGGGGCTCCTAGCGGATTTTCTC
CTGATATGGAGGCAAAGGATCGACAACAGGCATTATATAAAGCTGTCTGCGAGCCTATTATCCGTAGAgcatttcttcttcttcagttggCACCTGCGCC
GATCCAGTCCGCCCcatcagcgtcttctccaatGAAGCTTCTTCCTGGAATCTCGATGGCAAAAACTTACGGTGAGGTTTGTCCTTGTTTGCTTTGATCA
ATCTTACTTATCTAACATGTAGAAATGCGGACAGATTTCGCGAAAGTTTCTCAGAGTGAGCCGGCTGAAGCTACACTCGAAGAGCCCGAGCAAAAGCGTT
TTACACGCCAGTTAAACAAGCTGATGGAAACAAAGTCGGTAGAAGTgatggaagaagaagacgagcagaTACATGCGGATATTTTCTCGTTCATTCAGCA
ATCAAGCAGTAATCTGCTTACTTCCAGTCGGGAGGGCGAAATGCCGTCTCGACATCCCGAAGACCAAATGCGAGACATCTTGGTTGCACATCAGCGTCGC
GCGAAAAAGCGTCTACAAGGTCTCAAGACCTTTGTTCGTTTGCTCCAGAACACCGAAAATCTTCCAAGTTCGCGGTTCCACGTTATTCCCATGCTGTCTT
CTGCTTTCAAGCGCGTTCGTATGAGCAGTGGCCAAAACTTGGGAAAGCTATCAGCAGGACAAGCTTCGACCGTCAAAGTGCACTATCTAGTTGATCTAGA
ATTTGCTGGACCTCAGCTATCGGACGCCATTGGGCGAGAATTTTTCCTTTTGCTgactcttcttctcgaaacATCCACGGATCACCTtcaccaagtccag
cagctcatcgaagCCGGAGCGGGTCGTGGAACGAGTGATATGCAGTCATCGCCAGCGTCTATTCAGCATGCTGTGCACGATATGCTACTTGTGTTGGAGA
CTTGCTGCTTTCCTTACAGAGGCCAGGACTGGGACCACCTTCAGCGTACCAATTTGGTATCGCTGTTGACAGATCTGACGAGTTGGAAGGGATGGCAAAC
CTTCATCCAGTTCGATGCATCAGACAACTCACCGGCAGATGCTAACAGCTCCGAGACGTACACCATACTTCCTGCTGCCACGGGATCAAAATACCCGAAC
ATAATTTGTTCCCGGTATATCACGCTTGGTACCGATCTCCGTAAATTGACGATAGCTCATAAAAGCCTCGATCGAACCAACGAAAGTGTGCGGACATCAA
GTATATCCCAGGATAGTGGTGGACTTGCGGTATTTGACAAAACTTTCTACAGGGGTCGTTGGTATTGGGAGGTTTCAGTACGTACACTTGGCGATACTCC
TGTGTTTGTTGGTATCACCCCCGGCACAGCAGATCTTAATACGTATGTCCCGGGTGATGGCGGTCTCTGCGGGGTACTTCTACACCGCGAAGGATGTAGT
GGAAACGTTCCAGCAGGACTTCGATGGAATTGTACGGATGTTCTTGGCGTTCTGCTAAATTGTGAGGAACGACAAGTGGAGTTTTACAACGGTGGGAAGA
GGTGCTACGTGGCCTCGTTAGCTTCATACGATTCGGTTGGATGCTTTCCTTCAATCGGTGTCAAAGATGCCGATGTGCATTGGAATCTCGCGCCCTCTGT
CCCGTCAAAGTTATGGTGTGCCAGCTCCAACTTCCAATTCCCAAACGCAGTCGTTTCTGGAGGGCTTGTAGCAGCTCCTTTTGATGGAGCATCTATTAGT
TGGAACGGAAATCTTAAGGGGAGTCACCTGCAACTTATGCCAAATGGAACAACTGTGTCTGCCGGTGACTGCAGTTCATCTGAAGATCAGTTCGAGACTA
TTGTTGCAAGTCAGGGTTTCGAATATGAAAGTGTTTTCATTGAGATTCGCGTTGTAGCGGCGGGAAAAGGCGGACGGTCAGCACTCAGTTTTGGCGTTGT
TAGCAATGACTATTCGGAGTTTGATGTGCCGCTTGAGCACAAGCTGGACGTCACGTGGAAGAGTGCAGAGGAGGTGTTGAAGTGGGGGATTTTTGGAATT
TTGTTTGATTTCGAAAAGGCGACCGTAATTTTGTACTCTGACCGCTCGGAACCGGAGGTATACCACTTTAATCTTGTGACGCTGAGCAAACCCCTCTTTC
CTGCAGTGTCAGCGCTCTGCAATGGCACAGTCTTTGACGTGAACTTCCATCCTCGCCCTCGTCTCGAATTACCTTCACACGCATTCTACCCCGCAACAAA
ACTTCTGAACCATCACATGTCTTCATCGAACGAGCTACAACTGGGGAAGagtctgcagctccaagtgTATTCTTGTGATGGCGGAGAGTTTAGCAGTTCA
CATGTCGCCCACAATTGTCTTCTGGATGATACAACAACGGTTTATAGCTCTTCTAAAGGAGCAAACGTTAACTTGGTGCTGAAGCATGAGATTGATACTC
CTATGTGCGTAAGCTACGTCCATCTCCGAGGTCCTGGGTCAGGTTACTCGAGTCCTCTTCATTGTGCCATCGTATTTATCACCAGCACCCCTCCTGATGT
AGCGTGCTATCAGGAGTTTGATGACATGACCGCGGAAGAATTTGCTGCTTTACCATTTCCTCCAAGCAATGGGTGCTGTCCTCGCGATGAGAACGTTCCA
GTAGCATTCTTCGTACTGGACGGTAGCTGTGCTCAGATTTCAAAGCAGCTTGCCTATCCAGTTACTGGTCGGTACATTCTCATTAAAGCGATATGTCCGT
CAGCTGGAACAAATATCGATATCGGATACATTGGGTTCTGCGGCATTTTCGATCGTGACAATGGGCCTGCGTACAACGAGACCACGACAGGATCTTACAG
CTGTGAGGAATGTAAGAGAATGTCGTTATGTGGAGTACATTACGGACAAAGAGAAGATGACAGCATTAAGCTGTGTGCTGCGTGCTATGATGACAATCGA
GGTGACCTAGATTCCGCTTACTACGCCTACACTTCTGAGGAGTCTCAAGACGATCATATGAATGCAAACACGTTGCTTTGCCCTCCACGAAGGTCGTGGA
ACGATAAGGTTGCAACGCTATGCGACGTCTTGGACAAGTCTAAATCGCCAAATACAGCCGGGAATGGAAACGCAGTAGCAACCGCACCAGGACAAACTGG
CAGATCCGAAAGATTGCCTAGTGTGGCCAGTTTCGATGATTGCGAACTATTTTCTTGCGGGCAAAACAACTACGGAGAACTCTGCTTGGGGCACTGCAAC
TCAACAAGCAAGTTGGAACACGTACCTTTCTTTTCTGCGAAGGCAGTTCGAGATATTGCCGGAGGCAATGAAGTTCTCGCTGTAGTGATGAAGGACGGTG
CTGTTTTCACGTGTGGTCTCAACAAGAGTGGCCAATGTGGAAATGGTACTTTTGAAGAGCGAGTTATTATCGCCACCCCCGTTCGCGCACTTAGCGGAAT
CGCCATTAACATGGTAGCTGCGGCAAATGGTTGCGAGCACATGTTAGCTGTTGCGTCCGACGGTGCTGTATACTCTTGGGGATACAACGATCGTGGTCAG
TTAGGACTTGGGTCGACGATTTCAAAGAGTCATACGCCACGCATGATTGATAGTTTGCGCGAAAAGTATCACATAACAACGGCAGCAGTGAGCTATCATC
ACAGCGCAGTAGTATCAAGCAGCGGTGAGCTGCTAACGTTTGGTATGAACGACTGCGGGCAACTGGGTCTCGATCACACGCAACATCAGCACACACCGCA
ATTGATAGACTCATTATCGAGCCAAGTTATCACGAAGGTGGCGTGCGGACTCTATCACACTATCGCAATTACTAGTGGCGGAGAGGTGTATTCGTTCGGA
AAGAATGACTATGGACAGCTGGGTCTAGGTCATGCTCGCAACATGAAGGTGCCAACTCTGGTAAAGACAGCGCTTGGGGAGAGCGATGAGAAAATTGTAG
ATGTGGGTTGTGGTTACTATCACACAGTGACGATCAGCGAGAAAGGCAAGCTTATCACGTGGGGACGGAATGACTATGGGCAACTGGGAATCGGAAGCAA
AGATCACAAGAATAGCGCCCAGTATGTGCCACTGCCTTTGTCATCAAAGATTACTTCTGCATCATGCGGTTGCTATCACACACTCATTATGATGTCGAAT
GGGCGGGTGATGGTATTTGGACGTAACAACAAGGGTCAACTTGGGGCTGGGTCAAGGACGCTTCCTTCTGCAGACCTACCTTTGCCGGTGCCTTCAAACT
CACTGGCAAACGATGAAGTGGTTCGTATAGCTGCTGGGTTTTATAGCTCCTATATCCTAACCGGGCGTTCAGACGAGAGCCATGGACTTGATGACACACC
CGATGATGCCAGTCAGGCAAAAGACCTCCCGGAGAATAGCTGCATGGTGAACTCAGATGCACTTTTCGAGTCGTTGATGAAGGAGATTGACTCGAAATTC
ATCATAGACTCTTCGGTGACAAAGCGTGCGCCACTACAGATTAAGCGCGCACAGCGCAAGCTGCTACTCGTGAAGTTgcacgctgctggatggGCAATGG
CCCGCGCTCTAATGTATCGATCTCTTCGAGACGCCAACGACAGTACTAGAAATCGTTCGACTTTATCGAGTGGTCGTGTGAATCCAGTGCTATCCACATT
TATTAGCTTTTTGTTGGAGAATTTGGAATTACTGCAAGGTGATTCTGGAAATGGTAACATCAGCGCGATAATGATCGCGGGAGCGTCACACGAGTTGGGT
GCAAGTGTTTCGTTAAAGCGAGTATGCGTTGGCCTCCTGCAGTACTTTGGTGCCAAGGTTGTCGTACCTTCACCGGTGTCTGGGGCAATTGAAGGCACGT
CTCCGGACACTTCTCACGGTCACTTCTACAGGAATCAGATTTTAAGCGTTCTTCTAGCGTGCGGCTCTGCAAACACTAATGTTGGTTCCATCATCTCAAC
GAACTCGGTGGTTACGGCTCACATTATCAGTGGAATGGGCTCTTCCGATTTGGCAACGGCAACAATGTGCATTCGACTTGCGATGCTGGTATTCCCGCAG
CATTCAGTGTCCATGCTGAACAAAATCCACCGATCTCAACAATCAGCTCCAGTTCTCTCCGGAGATATTCTCAACATGTTGATGACACTGGTGGGTCTCC
CACTCCTTCTACGTCCGCGCCTCTGCTCACACGAGCTAGGCTTGGAATGCTCGAGCACTGCTCTATGCCAGTCAGCACGCTGTCTGAAAGGGGTAGCAGT
GAACAAAGACACAGGGATCGCACACATCCAACAAGTTGCGCTTGAGAAAGCGCATATTGCAGAGGCAAAGGCAGCTGAGGTTGTAGCATTGCTGCGGTAT
CTCACGCTTTACCCTACATGGAAAGTAGCGATCAACGCTGCGCTTACCCGAGCTTTTGCCAAGTCAAATACTGTTTGCGAGTTGCTGGATACCATTTGCG
CGTACTACACTAACGTTGAGCAGGCCGATGGTATGGAACTACAAACCGCAGTGCTTGAAGGCCTCAGCGGAGACAATGATACCACATCGTTGAGAAAACC
CGAAGCAACTACTTCGTCGCCAGAAACGGATGAGTCGACCTGCAACGCATCTGGTTGCAATACCCAGGCTGGCGACTCGGAAACTACCACCCGCGATAAG
CACTCGTTACTGCTTTGGCAAAAGGCAAAGGTTGCCCTTGATGGGTTAGCGACTGTCGTAGCAGCAGTAAGTATTGTCGGTGGGCATGTCGAATCTTTCA
GAGAAGGCGGATACGTCACcattgaagatgatggagtCCAGGGCTCGAGTAGATTGGGTGTGCTTTCAGGGATTACGAGGGACCCACGCACGGCTGATCT
CTTGGCCAAGGTAGTCGTGGAGTCCAGTTCTGATGCACTCGTCCCACCATTGATTGAAGGGGATGCACGAGCACAGATATTCGCACTCACCAAGCTTCAG
GTTGTGGAGCGCATACCGGCTCTTGTCGACATGTTTGATGACATTGAAAACATCATTATGACACTATCGTCGATGGCCTCCGGCATCTCCTCTGTTGAGG
AGGAGTGTGCCATGTACTGTGACCTTGACCTGCCTCAGAACAACTCCGTCCAGGAGGTGTTGCGAAACCGGCTTAAAAtgtacaagcagcaaatacGATG
GAGGTCATCGAAGGCGTTGTCGTCCTTACTGAAACAGATCCCGACTCTGAGTCCAACGCTCTTGAGTGTGGATTCACAACTCGTATCGAACCTGGCCACA
CTGCTATCGTCAGAAAATTCATTCTCGTGGGCAAGCAAGTCTGAAGTGTCAGCACTTGAAACTGCAAATACTCTTCAGAAGCGATGGCTTTGTGTAAAGC
AGCGACAAATCTTCTTGGATACAGAGGAGGTGATCGATTCCGCTCTGGACCATTACGAAGTCGAAATGCGCGACGAAGTTGTCCAAAAGTTGGGGAGTGA
AAATGCACTGAGTTGGGGAATGGATGCCATTCAGTCGCCTCGCCGTAAAGTGAATCATCCTTCGTTTGCAGGTGCTACTCCTGGTGGTTTCGGCTCAAAT
GGTTTACGCGGAGCTGGACAGCGATCAGATAGATCGAATGAAGGAGATTTACCGTTTGGTGCGTGGGGTGTTTTACTCCCCCTTCCACCATTAAATGAGA
ATGAGCACGGGCAAGCGGCTAGTGCATCTGCACACTCAGCCATTGACTACACGCCGTTCCCACTCACGGCGCCTATCATTCGGGTTGGTCGTGCCGCAGA
TGCATGTGATCTCATTGTCAACGATCGAAGTGTCAGTGGTCGCCACTTCCATTTGCGCCGACTGCGGCGCGAAACTGAGGGACGTGAAGAACAGTTCGAG
CTTCAGGATTTCAGCAAGAACGGGACTATCGTTAACGGCGTGAGAGTCCATGGATCCACCACTCTAATTACGACGGGGTCTCGAATTTCGCTAATACTGT
CCCGAGGTGGTTTGGTAACCTATGAATTTCAAGTTCGGGCACCTGGTGGTAGTATCGGTGGTCGCCATGCGCCACCCCCTATTGTCACGGCACAGCAAAA
CCCAGGTGATCTAAACATCTTGATTCCCGGTCAGGAGTACCAGCAACCGCAGATTGGCACTCCCCAGATTGTGCCGAGGAGCCCAGCAGAGTTACAGAAT
CGCGGGACTCGCGGAAGTTCTACCTCATCAGAAGGCCTCGTTGATGGCCGCAGCCGTCAGACAGTAACACAAGGCTTGCGTGTAATAACGTCCGTAGCAG
AGAGGGATGTTCCTCGAGCGTTACTCTCACCGAATCCTGCCGTGGATTCACCTCGAGCTGGCGGATATACTTCTCCTCGCTCCTCAGTGCTTCAAGCTCC
AGGTACTCCTGCTGTGAGGCCTCCAACTGCAAACATGTTTTCTACCATGATACCGGCTGCCATCCTTTCCCCAGCTTCTTACCAACAACGAGAAAGCTTT
GCACCGAACGAATCCACGGGGATAGCATCGCCTCGAACCCAGGACGGTGGTGTCGGTTCGATGCTTCGTATTGCGCTAGGTCGCGACAGTGTAAATCGCG
AGTCGTCTTCACAGCGGCCGGGTAGTATCCAGAACGAACTTGCAAAGACACGTGTTCTACGCTCAAGCGGTGACATCAGCTTGAACACCCGTTCGGTACG
TTTCGCTGTTGTGTTTATTTGGGTACAATGAGTTCCAAGGATTTTAAGTTATTTTCTTTTTCGTTGACACCTGTACAGAATGTATCGCCAAGTCTCCAGG
AGATGCAAGTACTTGCTGTACGTCTGCTTGCACGGGCTCAAGAAGCAAACCTTGGAGTCAGTGCTACTGAGTGTGAGAAAGCACTTCGTATGGCAGCCGG
TAATATGGATGAGGCATTCACGTTGATCCAGCAGAGTCGCGGATCAGACTCGGTAAGCGATTGCATACAACCAAATTCACTGCGAGGAGCTTAATTGTAT
CTAACCTAACCTGTATAGCTTTCTAATGTTATGCAGCGCAACTATCCTTCAAATGTGCGGCACTTAGCAATGGTTCTCGGACGAACTGAATCAGTGTGcg
cggaggcgctgcgccAAACAGATAACAATTATGGTGATGCACTGCGCTTTCTTCTGTCAAGCGCAGGCACTGAGCTGGGAAACTCTGTGTTATCACCCAA
GCGTCTCGATAATATGACACCAAGGGATGGCGCTTCAGTTTCTGGGACAAGTTTGCAGACAAACGAACCGCTGATTAACTTCCAAGATATCGGTAACGAG
AATCCAAGTTATGCTCTGACAGAGTCTAGCGCGTTGTGCCCTCCTGTAATTCAACGACTTACAACCAGAGCGAATGGTAGTCCTGTTaaaacgaagaaga
tggacaAGACTGGTAGTGCGGGCCTGGATACTCTACAAGCGAAGTCAGATCTAACACTCTGGAGCGAGTGCAACAGTAGCTTTGACGAAGGGGTTCGGCA
GATGAACGCAttcgagatcgagatcgagGAGGGAGTTCTCTGTGAGCGTCTGGCCGCCATACACGCACGCAAGATTCTTCACCAGATCGTGAGGCTTTTC
GATAACGCGTCGCAAAACGAGGAAGCGCCACTCAGTGAGCTTGGTAACCCGCTGGTTCTTCGTCCGTTGATTTCACTTCTAAACACGCCCGGGCAAGCCA
ACGCAAAGTCATCGTATGAGTCGTATGGGTCAGAGTATCAACTGCACCAACAGCCAAAGGCACAAAAGAGCGGGAAAATTCAACAGATCCTCTCGCGCAT
GGCGCAGGAAGTGATGTCGCGTTCCCCTACGCAGACGTTGTCTGGAAATCTGTGTTCATCCCAGAACTTATCTACTCTGCAACGATCAATTGACCAAGTG
ACAGAGCAGCCCAACAAGGTAGGTTGGACTGGTGTCACTCGTCTCATTGAATCTCTCGTCGAAAGCGAGCAAAGCAGAGAAATTAACGCTGGAGAGGACG
TTAATGTTCAGGATCAGTCCAACACATTGGAGAATGTCACGTTTGAAACGATCCTGCACATACTTTCTCGCACGCACGTAGCACCAGTCGCGACACTAAG
CTGGGACAGCTCACCGCTTCGATCCCGCAAAGCTGATGGATGTTTTCCGAAGGGGCCGATGCAGCTTTCGTGCGgtcttgaagttgttgtgGTTGATACG
TACGAGCGGTTATGGAGTGTCCCGCCGCCTGACCCACTACTCAAGCACCGTCACAAGTGGCGAAAGCGGTTTGCTACTAATGATAACGGATGGATGAAGT
CTGCAGCGGATTATGCCGTGACTATTTGGCGTCCGACGGTACCTCCAGCGCTCGAATCTACAACACCAGGCAATCAATGGTTCTGCCTCGGTGACATTGT
AAAATGCGGTAACGGTGCTCCAGATGCTCCAATGCTTCTCGTCAGTGACAGTGATAACCAAGGACGCTTGGTGCCCCCTGTAAATTTCGAACGAGTGGAC
ATTACTGGAAAAGGCTTGCCCAGAAATTCTGAAAGCGACCCGGATTTCCAGCGCAAACAACTACGCTCGATTTGGTGGCCTGTTGCGCCGTCTGGGTACG
TGGCACTAGGATGCGTAGCTGGAAGTAAGGAAGACCCTTTTGAGCCCCCAGAAGTCTCCAGCATACGCTGCGTTCGCGAAGATCTTGTCAAACGTGTTGA
GGCATTCCACTGCCTATGGCGCGCAACATCTCCTGCATCCACCGGTGGCGGAGGTGTAGAGCTTCCAGCTACAGTCGAGGTTGACAATGAAGCTCTGGAT
GAAGAGAACGATGATTTTGGTCAGGCTCTACAGGGTCGAAACACCAAGAACCAGTCTACTAACTCGTCTCggatgcagttgctgctacCTGTTGCCGATG
ATGTAGTCGTGCAGACATCTCTTTGGGCAGTGGATTCGAGCTTTAGTAGCGGTCTGCTTCTACCCGTGGTTACACTGAACGATGCTAGCGCTAGCGAGCC
CAGCTCCGCGTTTGCTCTGAACCTCTCGGACGAAGATGTCGTTCTGTGTGCACCAGTTAGTGTGGACAATGTACTCGCCTTCCTCGAGGTATTGCTTCAG
TACCAGCGGTTGCTAtcaagcaagcagcaagagaagAGAATGacctcgacgctgctgcgtcctgAACTACCAGCAGCCCTGTTTGCGCTGGTGCAACAAG
TGTTGCGTGAGAACCAACCGTCAAGTGGTCAAGCTGCCGTATCACTTGTGCGAGCACTCATTACGGTGGTTCAGCGCGGTGCACACTGGTATGACAAGCA
ATCGCTTCTTTATTGCCGCTCCAAGATCATGGCCCTTAGCCAAGACCAGGACGGCGGATTCACGTTGCACGCCCTGTTACAAGCTTTCGTGGAATTGATG
CTAGCTGTTGAAGATCAGCAACGGAGTTCACGGGTGCAAGAGCTAGCCGCCTGCATCGAACGCGACGGTGGTAGCTCACTGAGTTTGCCATACCGATTCC
ACTTTTCGAAGCAACCTTTCGTGGAGATGTTGGTGAGCCACTCGTCAAAAATGGCAGTCACTCGACACCTGTCAGGAGAAGAGCGAAAATTCTTGCTAGA
CTATCGAGCGGAAGATGGaagcaatgctgctgcgcggGAAGCGATGGCAGTGGAGGGACTCGGGGTTCCGCCCGGGGATGTGTATTCTTGCCGTTTTGAA
CACACCCCGGCTCTAGTGATGACAATGCGAGATGAGGTGAAGGCTGAAGTTGTGTATTTCGAGATCACTGTCGTGGAGTGGAGCGCTAGTACAAACGTGG
GAGGTTCACTCACGCTGGGGTTTTCGCCGCCGTCATTCCCGCTGGAAGGAGTACTAGTTGGCGGTAGCGCGGACGGTTCACGGTCTTACTCATTCGCACC
GGCAAACGGCCAAGTGCTCTGTGCCGGTGATACTGTTGTAGATCGTTGGCGATGGGTTGAACCCGCAGGTGCTGTGAGCCCTGGTGATGTATTCGGCTGT
GGTTTACGCCTAGATACGCAAGAAATTTTTTTCTGCAAGAATGGCCAGTTGCTAGGCACTGCTTTCTCGAGCATTTCAAGTcctctgcagctccatcctA
CAATTTCTTTTAATGCAGACTGCAATTTGCTTGCCAACCTGGGAGCTACGGCGACAACATCAGCTAAGCACGCCAATTTCAGCTTCCGGTTCCACTCGCT
TGACTGTGACAACTTAATGAGTGCCTTCGAATGGTTCGAACCACTCAGTCAAGTTTACGGCGTGATGAAGGCATTAATGGACCCGGCCAGGCCCGACGAG
GTGAACGCTGGTGACGAGCGAATTGAAGAATCGAGCGACACTGCTCAGCTGCCGGATGAGTTCATGCTGTCAGCTGATAATTTCTTGTCGGAAATCTCGG
AGGACGTATGCATCCGCGTGGAGAGCGCACACCCGTACGATCTAGAGCTGCAAGAGTCACTCGTTAGTATTCCATTAGCTACGAGTATTCGTGTGAGGTT
GGATCCTCAAAGTGAAACGGCCAGTTCTCACTGCCTGCAGATTCTACAAGGCGGAAGTACTTCGGGCAGTGAAGGTGGAGCTGATGGTGCGACGagtgga
ggaggcgaagcCGAAGTGCGAGCATTTACCGGTGCTTGCGGAGGGCAGGAGGTCACCATTGATGGGGACTGTTTCGTGTGGCGGTTTCCGGTGCAATCGA
ACTTCCAATGCCGCGTGGACCGCGTGCGCAAAGGACCATACCTTAAACTTGAGGCACGAGACACACGACTGTCACTTGTGCGCGATAAGGGCTGGCAAGC
AGGTATCGGTGTGGCACGTTTTGATGGAGGTGTGCACATCTGGGAGGTGCGCATTAGTTTCGTGACTGCAAGCTCAAACATCTTTTTGGGTATCGCTCGC
CGAGACGTTCGTTTGGACTCCTATTTAGGAAAAGATAACCGTGGATGGGGCTGGATCGGTAATCGTGCACTCTGGCACAATGGCAGCAAACAACGGGGCA
CTTATGGTGACAAGTTTAAGACGGGAGACACCGTCCGCCTCACACTGGATTTGCGTCGTGGCACACTCAGTTATGCGCTCAATGGCAAGGATTTAGGTGT
CGCCTTCGGCCCGGGTGGGACAGGCCCTAAGCTCGAGGGTACGTTCTACCCTGGCTTCGCATTGTACAACCAACGGGACTCGATTGATCTTATCGGTGGT
CATCGAGTCGAGGATGGAGGACTTGAGTCAGGTCTACCTCGAACGGGCAGTGGGCTCGCGAGTAGAGAGGATTCGTACtacagcgaagaagaagaagacc
tgGGAAGTTTCGTTGGGGGTGACGCGAGCCTTGGTGACGATGCCATTCCGAACTTCCGTATGGAGCTGGCTATCGCATTGAGTCAAATGGGTTTTCCTAT
GGAGTGGTGTCTCTACGCTTTGCGTCACTGCGAAGACGATGCTGAGCAGGCTGCAGACTATATTCTCGCCAATATGCACGCGATAGAAGCGCTTGTTCGT
GAAGAAAATGAGGCGATGGCGCGTCGCGCCCGCCACCGTCAGCTACTACACGAACAGGCGCTATCCCTGTCTGAAAACTTTGACGGCGACGCGTTAGATA
CAACTTCGGTACACCCTCCACCTCCTATCGAAGGAGACGTAGACGCCGTTCGATCCGCAGAAGAGGTAACTACAGGTGACGTGTCGACACTGCCCCAACA
GCAGCCGCAACCGTCATCCGGAGACACCAAGTGGGGTGTAGCATTCACCGCCGTACCAGAATTCTCAGTTACTGGGCGCCGTCTATTAGCCACCAAATAC
GGTTCCAAACTGCGTCGCTTGCACGCATCACAACGTGTATTTACTCCAGAACGTGATTGCGCTCTTGTGCAGCTCGTAAATGAGATATGCGAGTCACGCG
CCGAGGCTTTGTTAAGTTGTGACCCTCTCCGCATGACCCCAGAGGAATTTGTTCCAACAGAAGAGCAGATCCACGGATTTCCGGTACTGCGAGGTATTCC
TCTGGAAGCGCTCCAACGTCGCTTTTTGGTGTTGCGCAACTTCAATTGCCGATTGCAGACCACCCTCGCTTTCATCGACTTTTCGGCACACGACGAGCGT
TCTCTTCTAGCGCGTGGTGCGCGTGAACTTCGCGGCGTGGTCTTCCAGCACGTGAAGCTTGCATGGTGGCTCGGCGTTCTTAAAGAACAgcaagcaccag
ctgcagctcgtccagaaATTGAGGTCGACCGCCACCACGCTCAcgatgcgcttgagcttTCTGAGCGTGGTGATCCACTTGCAAGTGAAGCTGGTGAGCG
GGACAGTGTGTTCGCGCAgacgttcgagcagctgcatgGCCTGCAACCGGCATTGCTGCGAGGGGCTGACCGTGCATTTAAGTGCCAATTTGTGGGCGAG
TTCGGCGATGACTTCGGTGGTTTGTACCGTGAATGTTTGGCGCAACTAAGTTCCGAGCTGCAGACCTTCACACCAATGCTGCCTGTGTTACGGCCTTGCC
CCAACGCTCTGATGAGTACTGGCGAAAATCGTGAAGTTTTCGTGCCAAACTCGCACCTGCGCACAAACCCACGACGAGTACAGATGGCCGAGTTCCTTGG
TAAGCTCGCGGGTGTGGCTGTGCGGACTAAGACACCGCTAGACTTAAGTCTCCCGCCAGCAGTATGGAAGTTGCTGGTCGGACAACAAGTGACGCGCCGC
GATATTGAAGCCGTTCATAAAGGGTGCTTCCAGGTTGTAGACACGATTGCCAACCTTGATGCTCATGGCATCACCGAGACAATGTTTGACGAGATTGTGG
ACGCAAGCTTCACTGTGTTGTCAAGCACGCGAGAAACAGTCGAGTTAGTCCCTGGTGGACGTCACTTGCACGTCACATGGGGTGACCGTGAGGAATATGC
GCGCGCTGTCGAGATGTATCGCTTAACGGAGTTTGCGCCAGTGTGTGGGGATATATCTCGCGGTTTGGCGACTATCCTACCTGCACCTACGCTGGGTCTT
TTCTCGTGGCATGAGCTGCGGACTCTCGTGTGTGGTAAGGCCTCAGTCGATATAGATCTGTTACGGCGGCGTACCATATACGGTGACGGCTGCCAGGCAA
CCGACCCACACATCGCCTACTTCTGGGACGTCCTGGCAGAGTTCAGTGACGAGCAGAAATCGTCTTTCCTGCGTTTCGTCTGGTaagtcagcagcaaacc
aaACTTGGTGATGGTTGAGTGTGTTCTAATACGTTTTTGTGTATGCATTGCAGGGGACGGTCGCGTTTGCCTACACATGCTGCAGACTTCACGCAGGATT
TCAAAATCTCAGGGTTGCCCAAGGCTGCGGGTCGCGCCGATATGTACCTGCCTATTGCCCATACTTGTAAGTGTACTATGGTCCCTGGCACTGTTAGCTC
GTAGACTGACCCTTTGAGTGATTTACAGGCTTCTTTTCTATCGACCTGCCAGCTTACTCGTGCCACGAGGTCATGCATGACAAGCTTGTGTATGCCATCA
CTCACTGCCAGTCTATTGACGCGGATAACACGACGGTGGCTCaacgagctggccaaggcATTAACTGGACCAACGCTGCCGCCACGGCTACGGCcactgc
agccgctgcagtgTCGAATGTTATCGCCAGCATACCTACCATTGCTGGAGAGTGACCACCAGCCACTGCGTCGATATCAAAATGCATAGGACTGCATTCA
TTAGTCTTCATGTTTTCTATTCAATCAACACTCGCATGCCTACAGAGTTTCGTCTTCAACGGTGATTTTGACCTTCAAGTTCTCCAAGTTGGTCTGTTTC
TTCTGTGATACTTTACTGCGAGCGATCCGTGGAGGAACTGCTCGATGGAACGCACGCCCCCAGTCTCCATGATTTGCCACTTCATTCAGCACAATGATGA
CAGAATCTAGGTTCATGATGTGAGTTCGAACGCGTGTTCCGGATTGCTCAAAGTGCTCTTGAAGTGGCAATCGCGCGGTTCGAATGCCGCATGAAGATGC
CTTCGCCTTTGTCTCGCCCTGTTGGAGTTGTCAGATCCGAACGCGTTAGTAAAAATGGAAAATGAGGACAATCCATACTATATCGGGTAAGGacagtcag
tcagtcaccTTGCGGACGGAGCGATCAACGATGCCGCCTACGACATACACACAGGCTGGATCAAGCTTCTCGAGGACATTTTCCGAATCAGGTGAGAGGT
AGACGAGCTCATCAGCGTCATaaagctgctcaagcggtTCTTCGTGCCTTCCAATCTACCAAGTGATACGATACAACAAGTATCAGCACTAGCACTGTCG
TTTCTGAAGTAAAAGACGGTCGGTACCTTCCAGCTCAATGCGCCATGCTGAGCGcaaattgctgcaagttcgCGCGTACAAGATGCAAGATGCAGTGACA
CCAGTCTGTCCAGCGGACAAGTCTTCAGATATCCATACACGCATccgagctgcttcaaaatGCTGTGACGCTCCTTCCCAGCAAAAAAACACAAATTAAA
AATAAGTTAGCACGCAGATCGCTTCATAGGATTCCCCACATGAGTGCAATAGGACAGAACACACTCGAGTTGTCTGATCAGCTGCAAATGCCaagtccac
caccacccgAACGCCGCTCAtctgagcttcttccagcttttgctgcacgAAACAATCCGATGAGCCCATAAATCCGTACCAAGCACTAAGTATAATACTA
ATTCCGTTCATTGCAAACCCACATATTGCTCCACGCGTTGCATTCGGATCCGTTCTCGATGCTCGCTCTTCTGGTCCTCTGTCATTTCGGCCCGCTCGAC
CGCCAGCGCTTGACTACGACCCACTTTCTTGGCTTTCAACCGCTTGTCCTTGCGATTGCGGCGCTTCGAACGCAACATTTCACGGCGACATTGCTTGGTA
GTTTTCTCACTTTCGTTAAAGTTTCCCGGGGCATAGTAATAGCCGTACACGCCCAATACCCAACATGTCGTGACGATCACCACAGCGATGGCCACAGCCG
ACGGTCTCATCTTGTCACCCAAAGTTGCCCTTTAATCCAAGTAACTTTTCACGTCCTTTGGTTGGCTGATAAACTTATATACTATTTTGATTGGGTAAta
agctgctggtcgtaaCGGCCGCAGCCAATAGCTCACTTAACGAtggggaagaagaagcgccagCGCTCCGAGAGCTTTCAGGGCGAGCAggacggcgatg
gcgacgcccGCAAGCGGCTGGCAGCTTTCCACGCGCGGATGTTCGAATTGCCGCAAGAAGACGCGATGGTGGCGGCCCCAGAGACACCCCGCGTGCTGTT
CAAGtccaagcacaagaagcgcaagaagaaatccGCGGGCGGAGACGATGCGGACGACGGAGAGCCCGTGCCAATGGTGAAACTCAACATGAgcaagccg
aagaagaagaagaaagtggcgGCCGCTgtggaggtgcaggaggagaagaagaagacggtggtgacggGCCCAGCGGTCGTGAAGGCTCCGGGGATGCTCA
AGACCAATTCAGTGAAGAAAAAGGATAAGAAAGTCGTGGATCAGGTGGTTAAgaagttggagaagaaggtgcagaagaagaagcaggtTGCTGCTATCCA
GgcggtgaagaagacgacgcaggtGAAGACTGTTGCTGTGTGGCATTCGATACAAAAGGAtgacgcagaagaagaaaacgacgGAGTGGATCCGTTGGAA
CAGGCACTGGGAAGTATGAGGGAGATGGTAACGAAACAGGTTGCTAAGCCACCgtacaagaagcacaagacgGTAACGGGCAAGGCAGTTGCTGTAccga
agacggagaagctgaaggagattATGAAACCTGTACAGGGCAACAACTCGACTCGGAAAGCGTCAATGGAAAGCATTGTTGATGGCGACACGACTGGACA
TCTATTCAAGCGTAATAAAAAATGTCGGAAGAAACGGAAAAAGATGGAACAGCTAGCTGCAATGAAGATCAACGGCAGCAATCCACCTACAGCTGGAGCA
ATGGATGCACATGCGAAAGAAGGTAAAAAAGTCTCACCTGAAGCTAATGGAAAACCGACCCCAACCGATTTGATGAAGAAAACCCCCGTGAAGGATGTGG
CAAACAATGCATCCACTGCACCGTCACCAAAATCACCAGGCTCTCGCAAAAAACGGAAAAAATCTCCGAAGGTGAACGCAATGAATAACGTATCACCGAA
GACACATGCACCTGCACAACCCAGGCAAGGAAAACCGCTGATTATATCGGACAAACCAGAAAGTAAAGTTGTGAGCAGAACAGATACAGCGAAGGATGCC
AACACAGTCATATCCAAGAAGGCGAACACCGCGCCAGCAAAGAAGGGTAAAACTGCTAGCAAGCCTGCTGTCCCACCTACCAAGACGGTAGTTTCGAATG
ACGAAAAGAAGACCGCGGTGTCTTCACAACCCTTGACGCCGATTGCGGCTTCTCTAGCGAAGGGCGCAAAGAAGAAAGATGACATGTTCTTACCTACTCG
AGAAACACCACGTCGGTCTCCCGTTTCCTCAAAACGCGTAGAAAAGGCTGCGGCACCCCAAGTTGTTCAGCTCACGGATGAATCTTCGTCAGaaagcgaa
gacgacggtgcATTTGACGTCGACCACAATGACAGTGACAATGCGTCGTTATTTTCACGTCTCATTGATTCGGCTGCACGAGAGCGTTGGGAGCTTGTGG
AGGTTGGTCGGTTAGTTCGATTATTTGCTGCAGAGTGGGGGTTCAACGGGAGCACGACGGCACGATTCCTGTGCGAGACTTGCCCCGAACTTGTAAGCGT
TGATTTTCTGGAAGGTTTGGGTGTGAACTTGTCCTCGAAGCAGCTTGTGCAAATTTTTGAGGCTGGTTCGGGTAATTCTGGAGTGCTAATGAACAAAATG
GCGTCCGCTGTGGAGAATGGACATTTGAGTGTGCGCGATCCGACCTTTGTCTCGGCATTGGAGCGCCGTGTTGCGCTTATGGAGTCGAACGCTGAAgtga
tggagctgctgtatCCGCTTTTGGAGAGTTTGTCAACAGTGCGTGATGTCGGCTGTCTGTTGAAGCAGCTATGCGAGCACTGGCAGCTGGAGCGTAAGAT
TGCtttggtgcagcaggtgtTGTTGTCGAACGTATTTGACGATCTTGATGGCAACCAGGACGAAATCCTTCTAGACTTGCCTAATCTTACCGGGCGACTG
GACTTCCCGAGTCGTTTGGATCaggaagacgtcgacgagaaTGGTAATCTGAAGGGCTTCCTTGCCAACGAGGATAGCGAGTTTAGTGGTGAGGAGGTGT
CTGAGGAGGAACTGGACGAAGTTGACAgtgaggatgacgaggacCAGTACGAGGGTGAGACCGATTcagaggaggaggtcgagATCTCTGGTCGATCTCG
GGGCCGCAATCAGTTTATTGAAGATGAGGCCGATGtcggtgaagaagacgaggaagacgaggaaaaACAACGCCATGACGATGAtgcatcgtcttcatca
gaTAGTGACTGATAACGTGTGAGAGCGCAGTAAGTGTGTCGGAATTCAAAGACAGCTAGGATACCACCTGAGCGTAACTTGTATAACCGCCATTCAAACG
CTGTTAGTGGTGCTTCTTTTAAGTGTTGGTCTCCCAACATGGCAAAGCTAGCCTAGAACTACGACGAAAACATGGCGTTCAAGACAGCCAGTATGGCAAA
AATCAAGGCAACCCAAATGTACGGAGCCATGCCACTGCTTTCCTTGCTACTCTTGGAAACCTTTTTCTTAGAGTGAGCGATAGCGGCTGCATTGTTTTCA
TCCATCGCATATGAGCACATTAAATCGATGAAAACCAATCAGGGAACAAGCTTGAAACGTACCGGCACGTGCCGCAGCAGTGTTGTCCTGGTACTGCTCA
TCATCACCATCCTTGCCGCGACGTCCACCTTTCTTCGACGATTTGGCCGCTGACGTGTCTTCCACTGGTTCTTCTGCATCGATGTCCTGCTCAAAAGTTT
GCTGGGCGGTCAAACCACTATTGCTAACGACGGCTATCAAATCCGGGAACGCAGTAGTCAGCGCCTCCGCGGCCGCGGTGGGCCAATTTGCAGTTGGGTC
ACAGTGCATCGCCTCCGAGTGCAGAGGCGTGTTTCCATGAGTATTCTTGAGAGGCTTCGCACCCTACAAATACAACAATAGCGCCGTGAGATCCTGGCTA
GCATTTTCTTTCTTCAGTGCCAGGTTGGAGATCCAGGACAAACCTTGGAGATCAAGTAACTGATCAACTCGAGCTGGTCGTCGCTGTTCTTGATACAAGC
CCAGTGCCTGCAAgcatcagcaccaacttTTAGCACCACAAACATTaaacaactgcagcaaaaaGTAACAAATTGCAACATCCTTACAGTGACGTGTTGC
CCTTGGCGTCCACGACGTTAACGTTGGCACGACCCGTTTCAATCAGTAGCTGGACGATCTCGAGGTTTCCCTTTCCAACCGCGATATGGAGcgccgtcat
cttcttgttGTCAACTGCATCCACCTTGCTCTTGgctctcagcagcagcttcaaggacTCCACTTCCTCATACTCTGGACCGTGCACAGCACAATGTTTA
GTATCCAGCAAAACCTCCCAAAACCAACTTCGAACGACGAGATGATAATGTCCTCCAACCTGCTGCCAGATGCAGAACCGTCTGACCCGACGAGTCCTGC
ACATTCAAGTCCGGTTTGCCTTTGAGCAGAGCTTGAAATATTTCTTCAAAGCTCGGCGGCTGCTGAGCCAGAGCCAACATCAGCGGCGTGAAgcggcgct
tcttctcctgcaggTTGAGCATGGCGCCATTAGCCACGAGATACTGCACAATCTCCAGTTGGTCTTCGGCCACAGCCACGTGCAGCACTgcgaacaacaa
caaatgAAAATCAAATAATAAGTTTACAAAACAATTGCAAAAAACTTGGTGCCGGATACAATAACAACAGCAACTGTATCTTTTGGCTTGGAGATTTTGG
GTGTCGTACCGGACTCGCCCTTCTTGTTCTGGAAAGCCCAGTCGCTGCGCAACTCGATCATCTTGTCGAGGTTGCCGTTCGCTGTTATAAAGTGAACAAG
GTAATGTGTGAATATGCGTACTACGGACGAAATCCTAGCCTTCTCGGGGACACATACCTGCAGCGCGGAGTAATTGCGCCATGATGTCAAAACGAAGATT
GAATTTGGGATTGAGGGGGAGTGATAATATTGTGATATTTGGATTATTGACCAATTACTGAACTTGAAAATGTCGGTTTTAAGGTGAAACTTGATGTTGT
AGAAACTCAATGGATTGTACACCGAGACGCGGAAGTCCATGCTGCATGTCTGCTGCCTCACTGTCCTAAAACTTGATCGATGCCTACTCATGTACTAGTA
ATTGGTGACCAGTCAATTTTTGACCTGGTCGAACTTTGCTGCGGATAAATTAAAAGTTGCACTGTAGTTGCGTACCACTCGCTAGAGCTGGAAGTTCTGC
TGCGATTCCTTGTAGACCGCATCCTGTTCGTCCGAAGTCTACAACACCGAGGCAGGGAACGATGCAGCGACAGTTGAAGAGTTGGACGGTGTGAGGTGGG
GAGAGGGAAATTTGggaggcagcgacgacgcaaGAGGCGTAGACGAAATATTACTCGCTCCACCCGGGATATGCACCACCGGAGTCAGCACGTGGGCGCT
GCTGGAATCCGTCTTCACCTGCGGCTCAATGTTGAGCTTAATCTTGGACACGGCGGGCGCCATGCGGGTGTCGCGCTCCACCTCATGGAACATGTCCtcg
gtgctggacaagatctgcagcagactcGGATagctcgagaacgacgacaagttcaccTTGCGGCGCATGTACTTGGAGCGTGTGTTGTAACCCGTCATCT
TGTCGTGTTTTTTGAGGATCTGGAATACAAAAGCGACATAAATTAGACTCGTGCATCCCCTGAAGGTCACTCACTCACCGCGATCAATCTCACCTTGGAA
AATCCCTGGTAGTTCATCACGGCGAAGTTTTCGAGGCGGATGCACTCGCGGTAGAAGTGCACGAAGGCGAACATCAGTCGCTGCGCCTCGAACGCCTCGA
TCTTTTTTGTCTTCTGCATGATACATCAATTCACACAGCGATTAGCAGTAGATAATCAATCAAATATCCATAGCTGCCACGGACCTTGAGGTTCTTGAGT
ACGGAGCGTAGCTGCTGGTAGCGGAAAGAGCAGCGCTTCTCCTCCGCAGCGTAGAAGAGCGAGATCTTCTTAAGTTCAGTCTGCAGGTCACGGAAGAAGG
CTACCTCCAGTTCGGATTCGGCTGTCAGGTAGAAAGAAGACCAAGTCAGCATTTAACcagaacagcttcaacggcTCCACTATAACGTACAAATGTCGCG
CTGATTGGCGGCGTGGTGTGCCGCGCGGGTCACGGCCTTAATGCGCTTCTTGAGGGTTTTATAGTTGAGCCAGAAGGGCGCCCACTCCGGGTTACTCTGA
AGGATCTCCTGCAGTAAACCTTTGCCGAACTTCATGGCGGCGATGGGGCTGAATTGACGACACGAGGGTTCGACAGGTCAGTCCTGCACTGCAGCGATTG
GGAAGTGATGAGCGCCGCCGTGTTGGGCCGGCGAGAGGACGGTCAGAGATTCCGAATCGCTGCTCGACTCCGACAATAAGCTGCATTATAGCTAAAACCC
CAGCAAATGCCTGCCCAGGTGTCAATTCAATCTTCCACCGCTTGCTTCAAGTGGCTGTTTCGGAGATTCACAAAAAATCAAACTCGGCGGGCGACTTACA
ATTTACTCGAGGAACTCTGTCGGAATTATCACGAAGTAAACCTTAAAATGGgtttgtttgcttattttAAGCCTTTCAAGGTTACTTTATGAGCTATTTC
TTCATGTGAAACAATCCTAGAAAAAGTGCACCGAGATTCGAGATTCGCTGTACGCGTGCGCAATACTGAAGCCAGGTGTCAACCGGACGACCGGAAAGCA
GACGGAGATTCGGCTTGACACGAAAAAGCAGCGACGCACTCGGCGTCATCACAGCGAAACC