Description :
From Genome Similarity Track
Location :
Scaffold_365:498- 8440
Sequence
7942 bases(100 bases per row)
CGAAACTAGATGCACGATAAGGCGAAGATGCGATCGCCTGAGCTCGAGGACGACTTTGTGAAGGCTTCATCTGTTAAGTAGCAGGTGGACAAGGCGGAGA
AGCAGACATACAACGTCCTCCTCAGCGTTTGCTGCACTGCCATTATTCAAACAACAACCTGAAGAAAACACCAGCACCCGACGGCTTGCCATGTACTCTC
TGCCTCCGCCCCCAACGCTCGAAATGTTCATGTCGTCGCGACCGGCTCCGATATCCTTGAACCGGCGAGCACCGCCTCCGAGGCCGGCTTGGGGTCAACC
ACAACAGCTCCCGATGCCCTCTTCCGACTACCCATCGTTGTTTCAGTCTGCACAGCGGACTCCAAAGCCCTTGAACCAGCAACGATCGCTTTCGAGGCCG
GCTTGGGGTCAACCATGGCAACCTCCTAGGCCGGCCTGGGGTCAACCACAACAGCCCCCGATGCCTACTTCGGACTATCCATCGTTGCATCAGGCTACAC
AAACGACTCCGAAGTCTTTGAACCAGCAACCACCACCTTCGAAACCAGCTTGGGGTCAACAACGACAGCCTCCGAGGTCAACCTCAGCACCCGCCCAAGC
CAGTTTGGGGCCAACCTCAAAAACCTCCGACGCCCTCTTCGGACTATCCATCGCTGCAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAGTAGTTGTGTTTTCGGCTAATAATATTAC
TATTTGATACTAGAGGCATATTGGCTAACGCAGGGACACATGTTGGCGCTCGGTCGGTTCAATAGAGAAAACGGATTCGCTGCTGGGAGGCTCGCGCGTT
CGGCGGTCGCGGTTCGTCGCACGGGGCCGGTCTACTAGCTCAGGGTAGAACTCCACGCCTCCCAGTACTTCGGCATACGGTTTGTACAACGACGAAAAGT
CAAAGCAACCCTTCTTCTCAGGCTGACAGCGACGGCGGCGCCTAGTGTGACGGGGCACACAGCACTTCTTAACAGAGGAAGCAGGAGTATACAAACTCCA
AGTGAACAGCCGTTCACGTGTCCCTGGTCTGAAGGGGACGACTTGACTTGAAAAGCGGTAGATCTAAGACGGAATGTATTTATAGGCTGGTACAGATTTG
GCCTGCATACAAATCCTAAGTTCCCTTAGTTTGTGTCATACAAAATGTATCTATTGGCTCTGAGGCCACTTGGGTCACTATCCAGGGGAGTGATCGATGT
AGCCATCCCGGAATAGTGACAGGGTCACTATTCCATGTAACCCCATTACATCCTCCCCCACTTAGATTCGATCTTATCGACCAATCAGAGCGAGGTTACG
CCGGCGACTCACATTTCACTCGCAAAGTCGAAATCCATCGACAACGGCGCGAGCTCTGGCGCCTCGGCTCCCGGGCCTCACAGAGCAACTGGCGCATCGC
CGAGCAAGCCGCAGGGTCTCCACGTTGACCGGAAGCATGCCTCCAAAGCGCAGTGCGCGCAGTGCGAAAGCACCTCCGAAACCGCGGGCCGTAGGGCCGA
AGACCAGGGCGGCCAAGGCCAAGGACGAGTCGTCCGCGCTGATGGAGGCCACGAAGGCGGCCGAAGAGGTGGTGCGCTCTCGTAGCAGCACGCCGGAGAG
TGGTCGTCAGGCCGGGGCTCGGAGCAAGTCTCCTGACGCCGCACAAGGCAAGGAGGAGAGTCCTCGGGGCCATAAAAACCCGGCTCGCGACTGGGAAGCC
GCCGTCTTTGACTGCACGATGGTCCAGTACTCCGGTGAGAGTTCACCCGACGACGAGAACGTCTCGGAGGGCAGCACACACGCTGCCGAAGGCACGGAGC
TGGCGGCAGGCGACATGACCAACGCCTCGGCCGACGCAAAGGCCTCGTCAGAGAAGGAGGCGGAGGACGCCGAGTCCGGCTCAGGCGACAGCAAGCAGTC
GCACGACGAAGTCGCCATGGCCGACGCTGGGGTCGTGGCCGAGAAGTCGCCGAGCGATGCGGGCTCCAAGCCCAAGGAGGTGCTGGCATCCAGGCATCTG
ACGCTGGCACAAGGTCATGAGCGTGCCCAAGCATCGAAAGCGGCTGCCCATGCGAAGGCCGCCGAGGCCAAGGCGAAGAAGCGTTCAGCTTCCAGGTCGC
CTCGCGGCTCCAGCTCCAAGCTGTTCATCGACTCGGAGTCTGAGGACGAGGAGGGTGCCGTCCACGAGCCCAAGGAGCTCTCCAACAACCTCGACGAGCA
GCAGCAGCAATACCACGCTGCTAGCTCGGGTGCGTATGCCAGGCAGCCGACTGCCAGGACTGCCATCGAGTCTTCTTTAGGCGGGGATGCCACGTACCCG
CAGGGCTACTTCCCGCCCGAGCCTGGCACTGGTGCGCCAGCGCTGTTGGAGAAGCTCTCGGCTCCTCGTGGCCTTATCCGCGGGTACACCTCGAGGGGTT
CCTATGAGCGTGCTCTTGTTGAGAAAGAGCCACTCTTTCTTGGCGACGTTGAAGTCGCCCGGTGTGTGCTACTAGCACCACACAAGTTCACACTGAAGGA
GTTCACCACGCTTCGCAAGAAGCCGGAGGACAAGGGTGGACTCCATCCTGTGTGGGGTTTCCACTGGGTCAAGCCGAATGACAACATGACCTGGAGCGAG
GTGGAAGACCTCTTCTGGCGCTACGTCCAGCGCAAAGGGTATTCCGACCAAGAGTTCAAAGAACTCCGTGAGGATCGCACTCTGTCCGCAATCCTGGACG
TGCGCGAGCTCCGCATCGAGTTCGCTCAACTCGTGAGCAAGCGCAAGCTCCACTCGAAGATGGACGAGCTGAAGCAAGAGGCGAGAGCCAAAGCTCGTGA
AGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGTGCCCCGGGTACCGGCCAAGAAGCCAAGGACTACTTACGAAGCTGCCGCTGCTTCTCGTCCCATA
TCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCTCAACGGGCTCCCACGAGTTATCCGACTCAGGGTAACCCCTCCACTTCACGAGCAGCTGGCGCTT
GCCATGGAGCCGCCGCTCCCGGACGTCTCGTTCCACGTGGTAGTGGATCTGACCATTACGATCAAGGAGGGCCGGTGGTGGCCTCGCACGGCCATGGCTA
CGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCCAGTCAGGTGGTGGCCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTGTACGTCCTCG
AGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGCCGCTCGTGCTGGCCAGCCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCTCGCTCTATCA
AGAAACTCGCAGTCTCCATGGCCGTGTGGATCGTCGAGCCGACCTGTCGTCTTACGACTCGCTGCGAAACCAGCTCGCTGGCCTTCGGGCCAAGCTTCAT
GGCCACGCGCCGTATCCGGAGCAGCAGCAGCCCCACTCGTATCAGGCCCAGTTTGGCCAGGGCTCGTACGGGGCCCCTGCGTATGCTGCTCCGATGTACG
CCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCCTTACCGCGACCCGACGCCGCGCTTCGAGGAGCTGCGCTCTTCTCCACCGGGCCACCCACCGAT
TCCTGCGGGGCAGCCAGAGCCAGAGGGTCATGGTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGACTCGTCATCGACTTGGGCAAGTCTATGGTGT
ACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGTGCTTCAGCTTGTTGCTTTCGACCGAGCTAACAGTGTTTAGCGGTAGGTTTCT
AGTATCTAGGAGAACTAAATCCCCAACCTTAAACACGTTCATGTTTCCTCTTCCATTTCGGTCAGAGTACTCCTTCTGTTTATCTTGGGCTTGCACCATG
GTGTCTCGCACCCTGCTGATTATGTTCAGCCTGTCTTCGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTTGGGAGGAAA
AGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCAGTACTGCCTCGTAATGCGAGCGGCACCTGAGGGTGGCGCAACCCGTTCAGGTAAAAAAG
CGTAAAGCCCGTCGATGCATGTACCGCATTGTTGAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGATACTGCGG
AGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGTCTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAGGCGAAACA
GCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGC
GACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCG
GCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCA
CGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGAACGTCTTCTCACG
GCCGAGATGGCCACTGAATGGAGCGTCGTGCGCCTCCATCAG