Description :
From Genome Similarity Track
Location :
Scaffold_695:498- 4807
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_695-snap-gene-0.4Type I inositol-3,4-bisphosphate 4-phosphatase

Sequence
4309 bases(100 bases per row)
GGCAGCAGGTAGTTCTGCAACGCACTGAAGCAGTACTGCGCCTGGCCAATGTTCTTGCGGGCGTTCTCTCGCCGCACGCCGTGGGTGCGGAGCAGGGCCG
TGACGCGTTCGCGGTCGTTCGGGTGGAGCCCGTGGTGGAGCACGAGCAGCGACGCCTCTTCGAGCGTCACGGCCATGGACGTGCGGTCCTTGGCCGACTT
GCAGCACGTGACGCGGCCGCCGCCCACGGCTCTCGCGACCGCAGATGAGAGCGTGAGAATGTCCATGTGCTTGCCGCGGTCGGCGCGGGCCACGTGGTCC
TTGAGCTGCAGCGTCCAGTGGCGGACGCGCGGGACGAGCGTCTCGGTGTCTTCGAGCGGAGGCATCTGCCGCCGCCGCCACGCGCTCCACGCGTCCACGT
ACCGCTCGAGCACGGCCAGGTTCTCGTTGTTGATCTCGCGCTGGAGCGTGTCCTTGCCCACCGTGTTGGCCACGGTCTGCATCTCGTTCATGCCCTGGGA
AAAGATCACGGGCACGACGGCGATCGACTGGCGAAACACGCGGCGTGCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGAACGCGTCCTGGCCCAGCACGCGGTGCATGGTGCGCGTGGCAAACTGCTCGGGGGGCACGAC
GATCAGCGGCAGTTCCATCGTGAGACCGCGCTGGCCCGACGTCACCGAGACGCGAAACTGCGCCGCGCGTGGCGACTGCACGGGCCGCAGCTTGATCTGC
ACTTTCTCGAGCTCACGCACGGCCGCCTCCATGTCGCCCAGCATGCCGGCTTCTTTGCTATAGGTCGAGAGCAAGCTCTCGACCGAAAACACAAAGCCCA
CAGCCGCGAGCTGCTCAAGGTACGCGAGCCCGTGCGACGAACCCGAGTGCAAGTGCACGTAGAGCGTTTGCTGGAAGCACGTGGCGAGCGCACTCATGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGGGCTTC
GACCGTGAGCTCGGACCCGGCGCGCGACGCCTCGCGGGCCATGTGCTCGCTGAGTTTACTCAGTCGACTGCGTAGCTGGCGCACGCCGCCCTTACGGAAG
CCGTACACGTGGGCCGCAAAAGCACCGACAGTCGTGGTGCCGTACAGCTCATAGTTGGCAAACGGCTCAGTCGCCGATGCCTGTGCAGTGGACTTGGTTC
CACGGAGGGCGTGNNNNNNNNNNNNNNNNNNNNNGGCGTGCAGTGTCTCGCGCGCGGCCTTATCAAACGACGTGTGAGATCGCTGCTGCTGCCGTTGTTG
GTGACGAGCCACGGGCGACAAGACCGCATCGGGTTCCTGCTCGGCCTCGTCCAGCGCGTTTTCCACTCCCAGAGCGACGATCGACGCCGCGAGCTGCCGC
TGCTCACGCGACAGCGAACCGCCCGTGACATGCGAGTTGACAATCGTCTCCGCCGAGTCGAATGAAATCACGCGACGGCGCAGCGCCTCCATGGGCTCGG
GGGTGTCAGAGGCTTCCGAGCGGTCGTGGCCCCGGAGACGCCCCGCGGCTCCACCACCATGGGCGTGTAGTACCGCTTGCTCGTCCACTCCCTCTTCCTC
GTCCTCGTCCTCGGATGCGCTCTCCTGGAACAGCGCGTCCTCGACGGGGTCGGTTTCGAGGATTCGCGCTGATGATCGCGACGCCGTGCCCATTTTGGAA
GAGTCTACGAGATGAACGTAATGCTCGGCCTCGCCACGCCCACAAGGCCCCTCGCAGTCGTCGCCCTGCAGGTCCTTCGTCGACGCCGTGACGGCGCAGC
CCACGGACACGAGCTGCTGGTGGAGATTGAGCGCCAGGAAGCTCAGCCCCGAGTCGGCCTTCATCGTGCTCGGCTTGAATGTGAGGCCGCCGTGGTTGGA
ACTCTCGTACCGCAGAATCGCGGCCTCGACGTCGTCAATGTACTTTTCCATTTTCGCAACGAGCTCTTCCCCCCACTTCTTGCTCTTGCGCTCCATGGCG
TCGCCCTGGATCTGCATGATCATCTCCGAGAGCATGCCGACGCTCGGCGAGTTACTCGGACGAGTCGACAGGGTGCTCGAGACGGTGCGGTTCCCCGCGA
GCGCGTCCACACAGAGCTCGTCGCTTGGCTCGAGCAGCGCACGCTTGAGCACGTCCAGCTGCACGAGCAGATCCGAGAGAATGAGCTGCAGCAGTTGGTA
CGGGATCTCCCACGTGTAGACGCTCTCGATAAGCTCTTCCTCGACCAGCAGCTTGCAGCAGCGGGATGAGCGTGCAGCCGCCTTGGGGCTCTGTGGATCC
ACCCCACTGGCTGCCGTGGCAGTCGTCGGCTGATACACAAACGCGCGTGCGATCCGCTCTAGGCGTTCCGTGTCCACCACGCTCGCTCCGTGGAGCAGCG
GCGCCTCACACCTCACGACGAGCTCCCCCGATGAGTGGGTCCGCGACAACGGAGACTGTAGCTCGTGGACGCTGGCCGCACCGGCTGGCACCTGGAGTCC
CTGCGGCGACTGGTATGCTGCGAGCGGCACCATGGTGCTGCCAATGAGCCACTGGGTGTTGAGATCTTGGAGCGTCTTGGGCCGCGTGACGGCGTAAACG
GACGCGCGCAGCGTGCGGGACTCGTTCACTTGGACCGGCAGCATGACGTGGAAGTACGGGTCCGACGACGACGCAATCTCCGTGCGCCCAAACTCATTCA
GTGGCTCACTCGACTCGGTCTCAACCTCGTGAAGCACGAGCACGACCGCTGCGTCGCTCGCCGACGGCAGCTTGAGGTGAAAACACTGGAACGACATCCA
CACAAACACGCCGCCGCCGCCGCTGCTAGTCGCGGACGTATCGAGCGCGACGCCAGAGCTCTCGCGGGATCGCAAACCGCAGCCTTCGGCCGCCGCGGCT
GCTGGTGGCGACAGCAGCACGCACGAATCGTGCCGACCGCTGCTCGAGCGCGACATCGGCGACTCACTCCTCGCGCTCTGGACGCGTTGCATGGACACGG
ACGCGCTCGACCGCTCGTCGTCTTCAGCGCGCATGCCAAAGCTGTCTTCCAGCACCCGTCGCAGGCGACGCCGCGCCGTCGCAATGACATTTCCGCCCAG
CGCCAACGAAAGTGGGCTCGGTCGCTGCGTGCGCAATCCCACGGGCGCTGGCTGCAGTCCGGCCGTGTCGACGCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGGGCCGGCGGTCGCGCAGCAGCAGCGGCGTCGTCTCGGTCGCG
CGCGCCACGGCGACGGCATTGACGCTCGACTTGCGGCGCGACGGCAGCTCGAGATGTGGCTCGACCTCCCACATGAGCACGAGAAAGAGCGAGCACGGCA
CGAGCTCGGGCAGCCCATAGCCGATGAGCACGCACGCATTCGCGTCGCGGATCGTGCCGCACTGGGTCTGCGAGAACGGCCGCTGCAGGTACAGCACCGT
GCGCAGCAGAAAGAGCACCGAGCACACGCCCATGATGACGTTCGTCAGCCGCAGCGCGCGCTCGAGCTTGGCCTCGACGCGGTCGTTGAGGCGCTTGGGC
AGCTTCTGGTCGGCGAACTGGCGCAGCACGCGGCCGACGCGGCGCCGCGTCTTGCAGGTCGAGTACAAAAGCCCAAGTGAGGCCGCGAGGCTGCCCAGCG
CGATGAGCAGCACGGGGAGGAGATCCCAGAGGCGCGCGCGCTCCAGCAGCTCGGCGTCCGGACGGCGCGCGGCCTCGAGCACCGCGGTTTCTCGCCAGCG
AAACACGCACAGGCCCAGCACGGCGGCGTAGAACAGGGCGTTGGCGACGACAAAGGCGTTCCAGATGCGGCGCGACCGCGTCGAGACCTTGGCGTTGGCG
ATGTCGATCCAGAAGAGCACCTGGAAGAGCACGAGCGAAAAGAAGACGCAGAGCGCGAGGCGGTTGAGCAGCCCGCGCGCGAGCCCGCCGGGCGGGAGGA
ACGACGCCGCGCGCACGAGCGCAAAGACAAAGAGCAGCCGCTGGAACGTGCGCTGGCGCTGCAGCGCGTCGGCGCGCAGCCGCGAGGACGCCGAGGCGAT
CGAGAGCATGCGCGCGAGCGCCACGAGCGCCAGCGCCACGTAGAGCACGACGCAGAGCGCGGCGACGAGCGGCGACGCGCGCGGCAGAAAGACCATGCCG
TCGTCGTCC