Description :
From Genome Similarity Track
Location :
scaffold_1268:498- 2491
Transcript NameFunction/comments
Pl_100951Amino Acid/Auxin Permease (AAAP) Family

Sequence
1993 bases(100 bases per row)
CAGGAATCCTGAAAGGCAACATCGAGATACGGTTCGTGATGTGGCTGTGCATCATGCAAGCCCATCAACACATGCAGTGCATGTGTTGATGGGCTTGCAG
CTGATTTGTACGAGTGGGAATGCTCTCTGCAACACCAATCAGTGCTCGCCACCACGCAGCTTGTCACGGCCGATGCGTCCGAATCGGAACGCATCTGGAT
CTGATGGTCAACGGTCTTCAAATGTGCTTATACCCTTGATGTCGATGTCGTTGGCATTGCCGTTCGTGTCATCCTTACATTGATAGGGGTACACATACTT
GTGCATACCTGTTCAACACGCTCAAATGTCAATTGAACTGCGGAATTTTGCAGTGTCTTTGTCTCCGACTTACAGGCACAACAAAGACTTGCAGTTAACT
CTCTTTCATTGAAAGAGAAGTTTCAAAGCCAGGCAATCAGAAAACCAGGATGTCGATATTTGAAGTTTGGTGTACTTGCAATGCAAGCTACATCACCAGC
ATGTATATAATGAAACACCATACCGCTTCGATGAAGGTTCCCACCCATAACGATTCATACAATTATTGCCGAGGTTGGCCACCAATTGCGACTCGACGAA
GACTGTGAGGATGCTTTCATCTGGCGATGCGCGCCGCACAATTTGACCACACCGAGCAAGCACAAGTCAAACTCCGCGAAACCCTGCTGCACATTAAATC
TGGAAGAACTACAAGCATTTTATGTGTAGTCGTTGCTGGTTTGGTGCAGTCACGCAGTTGTATTAACTTAAGTATTTCTACAATAGGTGCTTGCTTCACC
GACACTCGGATTAAAATCAGTTGCTGTTAAAGAGCATGTGTTGATTTGCTGCGCCGTCTTTGGCGGTGGGAATGCCGGTGCGTGAGCATTTAACACAAAG
TGCGGTACTGGCGTTTGAATGCGCTCATAGGCTCATCGCCATCTGACGTCGCGCGGAGACCTGATAGCGGCCGCGCTCTCGTCCACAGAAGGCCCCTGCT
GCAACCCGTTCACCCCGTCGCTAACGTTGGCTACGCTCACAGCAGCGAGCTTGCTCAATGTATCGCCTGAGAACTCGCTAGTTGAACTGGCCCGAGTTTC
ATCGCCCACCTCATTGAAGCTCAGTCTTCATTTTTCCGCCTGCTCCTCAAGTGACAACCCGACCGACTCTACTTCATCATGGCGCGCTCTGCTGTCTTCA
CGATGGAAGACGCCAAGGCGGCCTTCAACCTTTTCTGCTGCGTCTACGGCATTGGAACGCTTGGTATGCCCGGTAACTTCTCCCGTGCCGGTCCCGTGAT
CGCAGTTATCGCCATGGCCTTCATGGCCTTTGCCAATACGTACTCCTCCGTCGCTATTTGCCGCGTCATGCTCCTCGCTCCGCGATCGGTCAAGACATAC
GGCGACCTCGGTGAATGGTGCATGGGTAAGCCTGGCCGATACCTCTCAGTCATTTCGCAGATGGGCAATTGTTTGCTGGTGCCTTGTGTGTTCCTCGTGC
TTGGTGGTACCCTCCTTGATGGCCTCTTTCCGGAAGCCTTTAGCGCCTCCACGTGGATTATCCTCATGGCACTTGCTTGTTTGCCTGTGTGCTTGATCCC
CACACTCAAGGAAGGTGCTGGTGCTGCCTTTGCGGGCTGTTTGGGCACCCTTATTGCTGATATCATTGGTGTTGCCGTCGTGATGCACGGCATGCGTGGT
CACCCAAGTGTGCCCAAGCCCGACATTACTTTCAAGCAAGTGGCTGGTGCTTTCGGCAATTTAGCTCTCGCATACGGTGCCGGTATCGTGATCCCGGCGC
TTCAGCGTCAGCACAGTGACCCTACGCGCATGCCCCGCGTCGTAGGAGTCACGATGTCGTTCATTTCATGTTGTTTCTTGGTTCTCGCAAGCACAGCGTA
CTCATCTGTCGGCTGTCAGATTTCGGGTAATCTACTGTGGTCGATTTACCCGGACTCAACGAGCGGCTTGACCACGCTAGGTTTTGCATCGGA