Description :
From Genome Similarity Track
Location :
Scaffold_1102:4979- 6734
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_1102-abinit-gene-0.13Adherance factor

Sequence
1755 bases(100 bases per row)
ACCTGCTCCTCAAGCTGAATCGCGGCAACACGGTGGTGGACACGCGGCTGGGACACTTTGCGGGACATACTTTGCGCCAAGACGTTGGTGGCCTTcgTTG
CTTCGATAAGCTCTGGCGCACGGTCGCGGGCCTCGTTGAAACGCGCACGTGCCATGGACACTTCGTCGAGGTTCACAGGCATAGTCTTCATGCGACCATG
TCCTCCACTACGTTGACGTGGTACTGGCATGTCCAGCTCACGCGATGCGCtCGAGGAAGCGGACGATGTCGAAGTGGCCGACGACGgCGAGAACCGCTGA
AGTTGCTCCATCGCATCCTCTTCATCCGAGTCTGACGATGAAGCAGAAGCACTGCACGCATCTCCTTCATCGTGATCAGtGTtGTTGCCCATCCGCATTT
GGTGTTGACGGAACGCTTCCAGTGAGATGGCGAGATCcGCTGGGCTTCCACGTCGCTTCGCAGAGAATAGAGTCTTTTTAATGATACCGTCACTGAAAGA
ACGCTGCGGTGGACTCGCCTTCGGGATCATAACGACCTCTGCACCATCTGAGAACGTCTTGTACTCGATGAGGCGGCTACGAACCGGGTCAAGGACATCA
TCCAGAGAGCGACGCTTTGCGTGAGAGAAGCTCTGGGTTCGACACACCGAAGCATTGCTGCCGTTACTGCTCCCGCTGCGCACGCTGCTGACATCTGAAT
CAACGGTCGTTGCGGATGGAGCACGGAGACCATGTGGAGAGCCACCAAGCAACAGCCCGCCTTCCTGAGGAGCTGGAGTCTTGGACGAGCGGCGAACGGC
AATAaCGCAAGCTGTGCAGACTCGAAGTTGTCGCTCGCCGACATCTGGAACAGTGGCAGTACGtAGCGAGCTGCAGCTGCTGCAGATGACCTCACCACAC
TTgAGGCAGTTGTACTTGCGGCGTAGAACGCAGAAGTTCTTCTGGCAGACATGGCAGTGGCCTAGCTCGCTCATTGGAATGACTTGCTGAGGAAgCACAA
TCTCGTCCTTGTCCGCACGGAAGGCCTCGATGTACTTAACAATACCCATGATACACTTTTCAACGTGTTGCTGGATGGCCGAGTTGGCGGCCCATGCTGG
GAGATCACCGTTCTTGTCGAAGTTGCAAGAATACGTAAGGCGGAGCTCACCTGGCTTCTTAGTTGTGTGGTACATGAAGCCCATAAGTGGGACGACATCC
CGGGTGTACTTGGGGGACTCGGCGTATGGCGAGTTGTTGGGAACGTCAaCTGACTCCATGATGCGgAAGGCAATCTTCTGGCCcTGATCATCTTCGATCA
TGTCAACATACTCCAGAATGATGAagTCTCGGTCTTTGCTGAAGCGGCTTGAGCTTTTGAAAGCAGCCCACTTGAGGGCGACGTGTCGGTGCGGGTTGAG
CTCGTTGGGCTCCACAATGGTCTGAACCACAGCGCCGTCAATAAAGTCGGACGAGAGCACtCGCATCATGCTCTTGTAGCTGTCGGTAGTGCTGGTGATC
ATGGACGCGGCAACGTCTTCAATGTCCGAGTTGAACTTGTACACCGCATGCACATTGATGGGCACATCGTTGGCCACATCGGCGCGGAAGAGCGAGATGC
CGTGCTTCTCGTGGACGAGTGCCCATGGCAAACCGCCCAGGAGGTCTGTCGCAGCGAGTAGGTCCTCTGTCATGGCCTTGGCCACAGCCGTGAGGCGCTC
CTTATCCTTGAGACTCATGTCGTCGGCGTCGCACGTGACAACGTCGGACGCGCTC